View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_high_8 (Length: 262)
Name: NF0607_high_8
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0607_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 40 - 238
Target Start/End: Complemental strand, 38850152 - 38849957
Alignment:
Q |
40 |
attaacaagtaccactacttggatccgtatcatgatgttaatgtttttaatgatttggcaataacatattcgcacatagtgaattaataaccgcggaaga |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
T |
38850152 |
attaacaagtaccactacttggatccgtatcatgatgttaatgtttttaatgatttggcaataacatattcgcaga--gtgaattaataaccgcggaaga |
38850055 |
T |
 |
Q |
140 |
caagaatttttagtcatggttttatcattaaaagcgataccacttacttgcttgcatccatatcctgatttgttggatatcactactgtcactgtttct |
238 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
38850054 |
caagaatttt-agtcatggttttatcattaaaagcgataccacttacttgcttgcatccatatcttgatttgttggatatcactactgtcactgtttct |
38849957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 38866092 - 38866143
Alignment:
Q |
127 |
taaccgcggaagacaagaatt-tttagtcatggttttatcattaaaagcgat |
177 |
Q |
|
|
||||| ||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
T |
38866092 |
taaccacggaagacaagaattatttagtcatggttttatcattaaaaacgat |
38866143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University