View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_1 (Length: 524)
Name: NF0607_low_1
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0607_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 85 - 259
Target Start/End: Complemental strand, 52767428 - 52767254
Alignment:
| Q |
85 |
atattttctcaaatcatatctaatgttccactagttgggaacaaatctaagctttctttcacttcttcattgacagaatttgtgatccttaaagccttca |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52767428 |
atattttctcaaatcatatctaatgttccactagttgggaacaaatctaagctttctttcacttcttcaatgacagaatttgtgatccttaaagccttca |
52767329 |
T |
 |
| Q |
185 |
aagtcaatatacaatgtcattgaagaatgcccttatcatcaagaaagtagtgtagcatcctcctactgagcagtg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52767328 |
aagtcaatatacaatgtcattgaagaatgcccttatcatcaagaaagtagtgtagcatcctcctactgagcagtg |
52767254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 257 - 462
Target Start/End: Complemental strand, 52767208 - 52767002
Alignment:
| Q |
257 |
gtgcctcagcttttggaggtaatttaaggatcaagtttggtcaatttttaggnnnnnnngcataatacttgggaattagtaactctctaaacgcttagct |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52767208 |
gtgcctcagcttttggaggtaatttaagaatcaagtttggtcaatttttaggtttttttgcataatacttgggcattagtaactctctaaacgcttagct |
52767109 |
T |
 |
| Q |
357 |
ctttgggggcaatgagagctgtcaagatagccaaagacaaaaactgaaataatttatagcttgagaaagactcgatgc-ttatggttttagctttaattc |
455 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52767108 |
ctttgggggcaatgagagctgttaagatagccaaagacaaaaactgaaataatttatagcttgagaaagactcgatgctttatggttttagctttaattc |
52767009 |
T |
 |
| Q |
456 |
ctctgtg |
462 |
Q |
| |
|
|| |||| |
|
|
| T |
52767008 |
ctttgtg |
52767002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University