View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_10 (Length: 334)
Name: NF0607_low_10
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0607_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 105 - 212
Target Start/End: Complemental strand, 17479052 - 17478945
Alignment:
| Q |
105 |
ctcaatcacctgataaagtacaggtattttcatttgattcttcaataattagaataaatttctgataaaaaacattcatgttggttattagccaattcta |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17479052 |
ctcaatcacctgataaagtacatgtattttcatttgattcttcaataattagaataagcttatgataaaaaacattcatgttggttattagccaattcta |
17478953 |
T |
 |
| Q |
205 |
tttgtttc |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
17478952 |
tttgtttc |
17478945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 39 - 107
Target Start/End: Complemental strand, 17479198 - 17479130
Alignment:
| Q |
39 |
aattcctgtgctggtacttggttatagattattttactcgtcgacggttctaacttttattttcctctc |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17479198 |
aattcatgtgctggtacttggttatagattattttactcgtcgacggttctaacttttattttcttctc |
17479130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University