View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0607_low_12 (Length: 321)

Name: NF0607_low_12
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0607_low_12
NF0607_low_12
[»] chr1 (1 HSPs)
chr1 (98-235)||(13298704-13298841)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 98 - 235
Target Start/End: Complemental strand, 13298841 - 13298704
Alignment:
98 agagagaaggataggcgccatgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaagttgtttgtttatttatttcaataatttaaca 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
13298841 agagagaaggataggcgccatgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaaattgtttgtttatttatttcaataatttaaca 13298742  T
198 gtccatgtatatatgtgaaaattgtatggatactgaac 235  Q
    |||||| |||||||||||||||||||||||||||||||    
13298741 gtccatttatatatgtgaaaattgtatggatactgaac 13298704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University