View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_13 (Length: 309)
Name: NF0607_low_13
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0607_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 24845234 - 24845458
Alignment:
Q |
1 |
aattttcttgttccaacatatgcttaagtgtgcagataaaaaggcccaagttgtgcctcaggtgaaaaagaatatcaagaccaaattacaagtcgtttct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
T |
24845234 |
aattttcttgttccaacatatgcttaagtgtgcagataaaaaggcccaagttgtgccttaggtgaaaaagaatatcaagaccaaattacaagtcgttcct |
24845333 |
T |
 |
Q |
101 |
ctggtatcgagtctcccgtcaaagtcgaaaacaatgaatgttttcgagaaacgtgactctagctccgaagagatccatcatcttgccaccatcatcagtt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24845334 |
ctggtatcgagtctcccgtcaaagtcgaaaacaatgaatgttttcgagaaacgtgactctagctccgaagagatccatcatcttgccaccatcatcagtt |
24845433 |
T |
 |
Q |
201 |
ttagacaagcatgtcctctagtggcacaat |
230 |
Q |
|
|
|||||| ||||||||||||||||||| |
|
|
T |
24845434 |
ttagac-----tgtcctctagtggcacaat |
24845458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1091 times since January 2019
Visitors: 3839