View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_15 (Length: 295)
Name: NF0607_low_15
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0607_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 89 - 200
Target Start/End: Complemental strand, 43463784 - 43463673
Alignment:
| Q |
89 |
attggaaaatcatcattcacaatatggtaataaaagttaatgttctgtataattaaacaattaatgcggtaagtttagtgattaaaaatcaagcggtaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43463784 |
attggaaaatcatcattcacaatatggtaataaaagttaatgttctgtataattaaacaattaatgcggtaagtttagtgattaaaaatcaagcggtaaa |
43463685 |
T |
|
| Q |
189 |
tgtgtaattttt |
200 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43463684 |
tgtgtaattttt |
43463673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 89 - 191
Target Start/End: Complemental strand, 43455063 - 43454961
Alignment:
| Q |
89 |
attggaaaatcatcattcacaatatggtaataaaagttaatgttctgtataattaaacaattaatgcggtaagtttagtgattaaaaatcaagcggtaaa |
188 |
Q |
| |
|
||||||| ||||||||||||||| | |||| |||| || |||||||| |||||||||||||||||||| | ||||||||| |||||||||||| |||| |
|
|
| T |
43455063 |
attggaacatcatcattcacaatttagtaacaaaaattcatgttctgcataattaaacaattaatgcgacagatttagtgatgaaaaatcaagcgctaaa |
43454964 |
T |
|
| Q |
189 |
tgt |
191 |
Q |
| |
|
||| |
|
|
| T |
43454963 |
tgt |
43454961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 621 times since January 2019
Visitors: 3836