View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_16 (Length: 291)
Name: NF0607_low_16
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0607_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 5416431 - 5416709
Alignment:
| Q |
1 |
gcatgattgttgttgtaacacattagattttggnnnnnnnttcatcttttttcctttaattctttggcaatagcagctgggtgagatcgtgctttcatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5416431 |
gcatgattgttgttgtaacacattagattttggcccccccttcatcccttttcctttaattctttggcaatagcagctgggtgagatcgtgctttcatgt |
5416530 |
T |
 |
| Q |
101 |
gaaactcaataagtccaaccatgttctcaagttatcatcatttcattcctttctcttattatatgctagagcctagaggccacatctacctttctttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5416531 |
gaaactcaataagtccaaccatgttctcaagttatcatcatttccttcctttctcttattatatgctagagcctagaggccacatctacctttctttctc |
5416630 |
T |
 |
| Q |
201 |
attataataaaaatttgcttatcttttcccatcatttgaatccttaaaatgtattaggcaatggtactgggagtatatt |
279 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5416631 |
attataatataaatttgcttatcttttcccatcatttgaatccttaaaatgtattaggcaatggtactgggagtatatt |
5416709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University