View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_17 (Length: 282)
Name: NF0607_low_17
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0607_low_17 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 55 - 282
Target Start/End: Original strand, 34085916 - 34086143
Alignment:
Q |
55 |
atcatccaccttcatgactaaatcccttgtctctattagatttgattcaacaaggtcgtctatctcctgatgcttcaaagcaacaacggtctgtaagctc |
154 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34085916 |
atcatccaccttcatgactaaatcccttgtctctattagatttgattccacaaggtcgtctatctcctgatgcttcaaagcaacaacggtctgtaagctc |
34086015 |
T |
 |
Q |
155 |
tcaaccttgttgaacaatacatcgttctcactgagcaatgtgacttctctttctttcagtttttcattagctatcactaatttattgatcataaaatctg |
254 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34086016 |
tcaaccttgttgaacaatacatcgttctcactgagcaatgtgacttctctttctttcagtttttcattagctatcactaatttattgatcataaaatctg |
34086115 |
T |
 |
Q |
255 |
cttccttcactgtctcttgggcttcttc |
282 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
34086116 |
cttccttcactgtctcttgggcttcttc |
34086143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 59
Target Start/End: Complemental strand, 30500937 - 30500891
Alignment:
Q |
13 |
aatatagtggataacttttctcatgtaactagtacaaccagtatcat |
59 |
Q |
|
|
||||| |||||||||||||||||||| | |||||||||||||||||| |
|
|
T |
30500937 |
aatatggtggataacttttctcatgtcattagtacaaccagtatcat |
30500891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University