View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_2 (Length: 507)
Name: NF0607_low_2
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0607_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 8e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 274 - 386
Target Start/End: Original strand, 30347557 - 30347669
Alignment:
| Q |
274 |
tttcaaagttcacattgtttagaaagaaatgtgtccataaacctattgtagataagattatgttcaagagcagtaacaaaagtaagagtgatcttgatac |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
30347557 |
tttcaaagttcacattgtttagaaagaaatgtgtccataaacctattgtagataagattatgttcaagagcaataacaagagtaagagtgatcttgatac |
30347656 |
T |
|
| Q |
374 |
tcttcagcaactt |
386 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
30347657 |
tcttcaacaactt |
30347669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 398 - 459
Target Start/End: Original strand, 30347860 - 30347921
Alignment:
| Q |
398 |
gttgtgtagaaatctatctaatttgtgtctctaagttcttaattgatgtctcagtatttctt |
459 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30347860 |
gttgtgtagaaatctacctaatttgtgtctctaagttcttaattgatgtttcagtatttctt |
30347921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 105 - 159
Target Start/End: Original strand, 24750499 - 24750553
Alignment:
| Q |
105 |
ctcttcacttggccccttgatgggtactttttctatacttccctcttttctcata |
159 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||| |||||||| | |||||| |
|
|
| T |
24750499 |
ctcttcacttggcccctcgatggatactttttccatatttccctctatgctcata |
24750553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 266 times since January 2019
Visitors: 3833