View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_low_9 (Length: 342)
Name: NF0607_low_9
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0607_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 71 - 262
Target Start/End: Original strand, 40725219 - 40725417
Alignment:
| Q |
71 |
gtcaagtagttagaaaatgggatgttcgaggtttaaatct------ttgtatttgttaataccatctctaccaacaactaaac-aagttcacgtgatatt |
163 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| || ||||||||||||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
40725219 |
gtcaagtaactagaaagtgggatgttcgaggtttaaatctcagcacttatatttgttaataccatctctatcaacaactgaactaagttcacgtgatatt |
40725318 |
T |
 |
| Q |
164 |
atcatagatcatagttgttcagtgcaggttccgtaagaaaaatactatcaaaagttttacgtataatatatatgagattaatttttatgcacaagctgt |
262 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40725319 |
atcatagatcacatttgttcagtgcaggttccgtgagaaaaatactatcaaaagttttacgtataatatatatgagattaatttttatgcacaagctgt |
40725417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 315
Target Start/End: Complemental strand, 20017456 - 20017396
Alignment:
| Q |
255 |
caagctgttgcaagttgttcaacaatccaagttcttttggaatttgacctgtgaggaaatt |
315 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||||||||| || ||||||||| |
|
|
| T |
20017456 |
caagctgttgcaagtttttcaacaatccaagctctgaaggaatttgacttgcgaggaaatt |
20017396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 255 - 315
Target Start/End: Original strand, 51805608 - 51805668
Alignment:
| Q |
255 |
caagctgttgcaagttgttcaacaatccaagttcttttggaatttgacctgtgaggaaatt |
315 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805608 |
caagctgttgcaagtttttcaacaatccaagttcttttggaatttgacctgtgaggaaatt |
51805668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University