View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_10 (Length: 368)
Name: NF0608_low_10
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 75 - 351
Target Start/End: Complemental strand, 33951534 - 33951252
Alignment:
| Q |
75 |
tggtcttattttcttgtgatatctcagtctttaaacatgtgttctttcattaaagttcgtatatatat------gcttagatttaaaacttaaaaataca |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33951534 |
tggtcttattttcttgtgatatctcagtctttaaatatgtgttctttcattaaagttcatatatatatatatatgcttagatttaaaacttaaaaataca |
33951435 |
T |
 |
| Q |
169 |
aatacaaaataaactaccttatctctagctattagtgtttttcattatgtcattcgttaaatatctcaatcagaatcttttcctttaacttggttataaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33951434 |
aatacaaaataaactaccttatctctagctattagtgtttttcattatgtcattcattaaatatctcaatcagaatcttttcgtttaacttggttataaa |
33951335 |
T |
 |
| Q |
269 |
ttccaaagggggtgtaaaactttatcatggtaaggagtggtggggggccttcaaaaacacatgcctctcctctcaatttggat |
351 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33951334 |
ttccaaaggaggtgtaaaactttatcatggtaaggagtggtggggggccttcaaaaacacatgcctctcctctcaatttggat |
33951252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University