View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_12 (Length: 358)
Name: NF0608_low_12
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 9e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 99 - 238
Target Start/End: Original strand, 17507904 - 17508046
Alignment:
| Q |
99 |
atcttcattctttacaagcttcatattcactttagctagtgtagattcaagattgcagctcat---gttgaatctcatcggaatatcaatatattatttc |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
17507904 |
atcttcattctttacaagcttcagattcacttcagctagtgtagattcaagattgcagctcatcaggttgaatctcttcgaaatatcaatatattatttc |
17508003 |
T |
|
| Q |
196 |
ttctaatgcattgctaaacctttcaaagttttagtgaattcca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17508004 |
ttctaatgcattgctaaacctttcaaagtcttagtgaattcca |
17508046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 171
Target Start/End: Complemental strand, 1831827 - 1831752
Alignment:
| Q |
99 |
atcttcattctttacaagcttcatattcactttagctagtgtagattcaagattgcagc---tcatgttgaatctc |
171 |
Q |
| |
|
||||||||||||||||||||| | |||||||| || | |||||||| || ||||| ||| |||||||||||||| |
|
|
| T |
1831827 |
atcttcattctttacaagcttaagattcacttcagatggtgtagatgcaggattgaagcccatcatgttgaatctc |
1831752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37 times since January 2019
Visitors: 3831