View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_13 (Length: 357)
Name: NF0608_low_13
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0608_low_13 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 95 - 357
Target Start/End: Original strand, 32428160 - 32428422
Alignment:
Q |
95 |
cctctttggattatattctaaaattgattaacatttgagatgattggagctaactctcacatcttatgtctcattccattaaatttttatgtttgattcc |
194 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32428160 |
cctctttggattatattctaaaattgattaacatttgagatgattggagctaactctcacatcttatgtctcattccattaaatttttatgtttgattcc |
32428259 |
T |
 |
Q |
195 |
aatgtaacgtttgtggtggctttggatccccatgtggattttagttgtggtgtttggt-cccatgcccataccatgggctcgtgctccactactgcccat |
293 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
T |
32428260 |
aatgtaacgtttgtggtggctttggatccccatgtgga-tttagttgtggtgtttggtccccatgcccataccatgggctcgtgctccactactgcctat |
32428358 |
T |
 |
Q |
294 |
attatctattacaaccagtggagttgtacaactcttgtaccaccagcatgatcccacagtcaac |
357 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32428359 |
attatctattacaatcagtggagttgtacaactcttgtaccaccagcatgatcccacagtcaac |
32428422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 186 times since January 2019
Visitors: 3833