View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_16 (Length: 327)
Name: NF0608_low_16
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 4 - 246
Target Start/End: Original strand, 30360797 - 30361039
Alignment:
| Q |
4 |
gaacctgtgtaaggggtttacggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatca |
103 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360797 |
gaacctgtgtaaggggtttgcggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatca |
30360896 |
T |
|
| Q |
104 |
tcattgaaaatatgcatgcttcgaaaagnnnnnnnngtcctggttgttaaaatttctttggaagaaaatacgcatgcttnnnnnnngtcttgattgctca |
203 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
30360897 |
tcattgaaaatatgcatgcttcgaaatgaaaaaaaagtcctggttgtttaaatttcttttgaagaaaatacgcatgcttaaaaaaagtcttgattgctca |
30360996 |
T |
|
| Q |
204 |
ctcttttaatactggttgcgccttaaattttctcatctgtgct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360997 |
ctcttttaatactggttgcgccttaaattttctcatctgtgct |
30361039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 9 - 129
Target Start/End: Original strand, 19916201 - 19916321
Alignment:
| Q |
9 |
tgtgtaaggggtttacggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcatt |
108 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19916201 |
tgtgtaaggggtttgcggaccttctctggaactgggattgggtccctgcaaggtacattcatatgaaaagaaatttaggctcactacttgtatcatcatt |
19916300 |
T |
|
| Q |
109 |
gaaaatatgcatgcttcgaaa |
129 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19916301 |
gaaaatatgcatgcttcgaaa |
19916321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11 times since January 2019
Visitors: 3832