View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_18 (Length: 316)
Name: NF0608_low_18
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 32 - 307
Target Start/End: Original strand, 37780641 - 37780895
Alignment:
| Q |
32 |
atttctttgtggattgtttgggtatgctactgaattgttcacctttttcttccatatagtattttcggtcatataaagagcctttatatgacattaatta |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
37780641 |
atttctttgtggattgtttgggtatgctactgaattgttcacctttttcttccattta-----------------aagagtctttatatgacatta---- |
37780719 |
T |
|
| Q |
132 |
aagatactaatatggtcaatgtatgttccaggggaagtttacttctaaacctttatggcatgggactgacttttatttcagcaacgtttatgatgtcgtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37780720 |
aagatactaatatggtcaatgtatgttccaggggaagtttacttctaaacctttatggcatgggactgacttttatttcagcaacgtttatgatgtcatt |
37780819 |
T |
|
| Q |
232 |
gtataaccttattccaggagttacctttatcatggccatatccttcgggtactcacacttttcactttagaataat |
307 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37780820 |
gtacaaccttattccaggagttaccttcatcatggccatatccttcgggtactcactcttttcactttagaataat |
37780895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 124 - 273
Target Start/End: Original strand, 37807470 - 37807619
Alignment:
| Q |
124 |
attaattaaagatactaatatggtcaatgta-tgttccaggggaagtttacttctaaacctttatggcatgggactgacttttatttcagcaacgtttat |
222 |
Q |
| |
|
|||||||||||||||||||||||| | |||| |||| ||||||||||||| ||||||||||||||||| | | || ||| | ||||||||||||||| |
|
|
| T |
37807470 |
attaattaaagatactaatatggtta-tgtaatgttgcaggggaagtttatttctaaacctttatggcgttgccctcgatttgacttcagcaacgtttat |
37807568 |
T |
|
| Q |
223 |
gatgtcgttgtataaccttattccaggagttacctttatcatggccatatc |
273 |
Q |
| |
|
| |||| ||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
37807569 |
gttgtccatgtccaaccttattccaggaattaccttcatcatggccatatc |
37807619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 741 times since January 2019
Visitors: 3837