View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_23 (Length: 304)
Name: NF0608_low_23
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0608_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 33 - 302
Target Start/End: Complemental strand, 38323550 - 38323281
Alignment:
Q |
33 |
atataggcaaaaataacaaggctggtccaagctgcatcctctaaagttttgtttgaaattttttctcctgatatcttcactctttatttggtttccatcg |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38323550 |
atataggcaaaaataacaaggctggtccaagctgcatcctctaaggttttgtttgaaattttttctcctgatatcttcactctttatttggtttccatcg |
38323451 |
T |
 |
Q |
133 |
gattccttcgacttgagataaccctgttcgaggcacgtctggacactaacatccttatgagtatagggacttctacatggcttttgataataaatcatgt |
232 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
38323450 |
gattccttcgacttgagataaccctgttcgaggcacgtctggacactaacatccttatgagtagagggacttctacatggcttttgataataaatcatgt |
38323351 |
T |
 |
Q |
233 |
ctccaatatccacaatgtctatcttttctatggaggatgatcttcttcttaatcttttcctagggttcct |
302 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
38323350 |
ctccaatatccacaatgtctatcttttctatggaggatgatcttcttcttgatcttttcctagggttcct |
38323281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University