View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_28 (Length: 293)
Name: NF0608_low_28
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0608_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 21 - 122
Target Start/End: Complemental strand, 20626038 - 20625936
Alignment:
Q |
21 |
ttcaaactactaccatactgctcatttagcacgnnnnnnnat-taagtttcttcttaggatcgaaataaaaaatatatataaacattcgcatttttagaa |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
20626038 |
ttcaaactactaccatactgctcatttagcacgtttttttaaataagtttcttcttaggatcgaaataaaaaatatatataaacattcgcattttcagaa |
20625939 |
T |
 |
Q |
120 |
ttg |
122 |
Q |
|
|
||| |
|
|
T |
20625938 |
ttg |
20625936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University