View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_30 (Length: 262)
Name: NF0608_low_30
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 32165558 - 32165319
Alignment:
| Q |
1 |
caaaaaagctctcacgaactttgtgacggcttctttttgccacaataaatggtagagtcacatttgaaattggggctactttgacagcaacaaaatgtac |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32165558 |
caaaaaagctctcacgaactttgtaacggcttctttttgccacaataaatggtagagtcacatttgaaattgtggctactttgacagcaacaaaatgtat |
32165459 |
T |
 |
| Q |
101 |
gaagagaactcaaattaaaatttatgtttgttttgacgacgacaaacttcatggagatttagacggttataaactttcttatgaattaaatcgccacaaa |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32165458 |
aaaaagaactcaaattaaaatttatgtttgttttgacgacaacaaacttcatggagatttaaacaattataaactttgttatgaattaaatcgccacaaa |
32165359 |
T |
 |
| Q |
201 |
ttccaccttactttatatatatatcacttcatttttctcatgtttcttcat |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32165358 |
ttccccct-----------tatatcacttcatttttctcatgtttcttcat |
32165319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University