View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_33 (Length: 251)
Name: NF0608_low_33
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 27 - 238
Target Start/End: Original strand, 9185249 - 9185461
Alignment:
| Q |
27 |
taaccaagcctcaatttgttatcatgcaaaa-ctgtttttaccacaacaatggcaacactgtttacaatatcctaaaacacctgttgacaatcatggtct |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9185249 |
taaccaagcctcaatttgttatcatgcaaaaactgtttttaccacaacaatggcaacactgtttacaatatcctaaaacacctgttgacaatcatggtct |
9185348 |
T |
 |
| Q |
126 |
ggtccctatatagatgaaactcccgacagaaacagctatatatatgatgcaaaccagatttcccaacacatcaacagctacataaaatttataaatgaga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9185349 |
ggtccctatatagatgaaactcccgacagaaacagctatatatatgatgcaaaccagatttcccaacacatcaacagctacataaaatttataaatgaga |
9185448 |
T |
 |
| Q |
226 |
caaagaatagcct |
238 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9185449 |
caaagaatagcct |
9185461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University