View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_34 (Length: 251)
Name: NF0608_low_34
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_34 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 21 - 251
Target Start/End: Complemental strand, 27990755 - 27990520
Alignment:
| Q |
21 |
acatcatcaaataagacatctattgtgcgacggaagggagtaaaatttattgtatcccaannnnnnnnnatgaaatctcccatagctaattctagtttaa |
120 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
27990755 |
acatcgtcaaataggacatctattgtgcgacgaaagggagtaaaatttattgtatcccaatttttttt-atgaaatctcccattgctaattctagtttaa |
27990657 |
T |
|
| Q |
121 |
caatgtatttgtatgcttgataaaagttgtttcaagtcaaacaatcacattcataaaattaatggtgggaaa------taaggtttaaattattttgtga |
214 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
27990656 |
cagtgtctttgtatgcttgataaaagttgtttcaagtcaaacaatcacattcataaaattaatggtgggaaatgggattgaggttaaaattattttgtga |
27990557 |
T |
|
| Q |
215 |
attttgatattggtataaaacacaaataaatatatcc |
251 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| |||| |
|
|
| T |
27990556 |
attttgatattggtacaaaatacaaataaatacatcc |
27990520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 28001019 - 28000970
Alignment:
| Q |
202 |
aattattttgtgaattttgatattggtataaaacacaaataaatatatcc |
251 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
28001019 |
aattattttatgaatttttatattggtacaaaacacaaataaatacatcc |
28000970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 10503404 - 10503452
Alignment:
| Q |
138 |
tgataaaagttgtttcaagtcaaacaatcacattcataaaattaatggt |
186 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
10503404 |
tgataaatgttgtttcaagtcaaacaatcacatttatcaaattaatggt |
10503452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 101 times since January 2019
Visitors: 3832