View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_38 (Length: 205)
Name: NF0608_low_38
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 58 - 183
Target Start/End: Original strand, 55319 - 55444
Alignment:
| Q |
58 |
attggctaattgaagcatcctctacagtttttcaactgtctagcaaaaaccaatctagaattgggaacctaaaatacgtatggaagaaccttcaggtgga |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55319 |
attggctaattgaagcatcctctacagtttttcaactgtctagcaaaaaccaatctagaattgggaacctaaaatacctatggaagaaccttcaggtgga |
55418 |
T |
 |
| Q |
158 |
catccttcaacttaagcattctttgt |
183 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
55419 |
catccttcaacttaagcattctttgt |
55444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 33 - 183
Target Start/End: Original strand, 33754997 - 33755139
Alignment:
| Q |
33 |
tagtttttgtaagaaagttaaaatcattggctaattgaagcatcctctacagtttttcaactgtctagcaaaaaccaatctagaattgggaacctaaaat |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||| ||| ||| ||| ||||| |
|
|
| T |
33754997 |
tagtttttgtaagaaagttaaaatctttggctaattgaagcatcctctacagtttttcaaatgagcgacaaaaactaatatag--------acccaaaat |
33755088 |
T |
 |
| Q |
133 |
acgtatggaagaaccttcaggtggacatccttcaacttaagcattctttgt |
183 |
Q |
| |
|
|| |||||| |||||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
33755089 |
accgatggaacaaccttcaggtggacacccttcaacttaagtactctttgt |
33755139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University