View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0608_low_39 (Length: 203)

Name: NF0608_low_39
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0608_low_39
NF0608_low_39
[»] chr3 (1 HSPs)
chr3 (102-203)||(34675265-34675366)
[»] chr4 (1 HSPs)
chr4 (102-203)||(43583254-43583355)
[»] chr7 (1 HSPs)
chr7 (136-200)||(12360773-12360837)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 102 - 203
Target Start/End: Complemental strand, 34675366 - 34675265
Alignment:
102 gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34675366 gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt 34675267  T
202 gc 203  Q
    ||    
34675266 gc 34675265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 203
Target Start/End: Complemental strand, 43583355 - 43583254
Alignment:
102 gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt 201  Q
    ||||||||| ||||| ||||| | ||||||||| ||||| || || || || ||||| |||||||||||||||||||| ||||| || || ||||| |||    
43583355 gtgagggagaagttcattgagaagctttgtgacattgctagcaccaaatattttgtgcacgtttgcaaatttttgaggctcttctggagggaagtaaggt 43583256  T
202 gc 203  Q
    ||    
43583255 gc 43583254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 200
Target Start/End: Original strand, 12360773 - 12360837
Alignment:
136 ttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatgg 200  Q
    |||||||| || || || |||||||| |||||||||||||| |||||||| ||||| || |||||    
12360773 ttgcttgcaccaaatattttgtgaacatttgcaaatttttgtggttcttctggtgggaaatatgg 12360837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University