View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0608_low_5 (Length: 446)
Name: NF0608_low_5
Description: NF0608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0608_low_5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 90 - 446
Target Start/End: Original strand, 49087368 - 49087724
Alignment:
| Q |
90 |
catctcccccctgacaaactacaaatgaacaaacctgctggtccaccaccttcttcttcctacggcacaagttcttccggacgtgcttttgccacattcc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087368 |
catctcccccctgacaaactacaaatgaacaaacctgctggtccaccaccttcttcttcctacggcacaagttcttccggacgtgcttttgccacattcc |
49087467 |
T |
|
| Q |
190 |
tcaccatctttctcctactaatcggtgtcactctacttgttctctggcttgtctaccgtccacacaaaccccacttcacggttgtcggtgctgccatcta |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087468 |
tcaccatctttctcctactaatcggtgtcactctacttgttctctggcttgtctaccgtccacacaaaccccacttcacggttgtcggtgctgccatcta |
49087567 |
T |
|
| Q |
290 |
tggcttcaacacaacctcaccaccgctcctttccgccaccttgcagttcaacatcctcattaagaacccaaacaagcgtgtctctgcttactatgacagg |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087568 |
tggcttcaacacaacctcaccaccgctcctttccgccaccttgcagttcaacatcctcattaagaacccaaacaagcgtgtctctgcttactatgacagg |
49087667 |
T |
|
| Q |
390 |
ttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccg |
446 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087668 |
ttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccg |
49087724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2261 times since January 2019
Visitors: 3815