View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0609_low_10 (Length: 211)
Name: NF0609_low_10
Description: NF0609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0609_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 32822463 - 32822533
Alignment:
| Q |
1 |
cgtttccgtctgctatgcagcggggatgnnnnnnngagagatttgttgcttttgctttgattgagtctctg |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822463 |
cgtttccgtctgctatgcagcggggatgtttttttgagagatttgttgcttttgctttgattgagtctctg |
32822533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3076 times since January 2019
Visitors: 3831