View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0610_high_25 (Length: 215)

Name: NF0610_high_25
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0610_high_25
NF0610_high_25
[»] chr2 (1 HSPs)
chr2 (1-136)||(9713833-9713968)
[»] chr8 (1 HSPs)
chr8 (85-132)||(16952563-16952611)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 9713968 - 9713833
Alignment:
1 catcgacgatactatattagaaataaatgagctatttacatattagtacggttaatttcacgacccttatatttacagttaatttggtgacttatagata 100  Q
    |||||||||||||| |||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||     
9713968 catcgacgatactacattagaaataaatgagttatctacatatcagtacggttaattttacgacccttatatttatagttaatttggtgacttatagatg 9713869  T
101 tcggttcaatacgaactacatatttattttcctttg 136  Q
    ||||||||||||||||||||||||||||||||||||    
9713868 tcggttcaatacgaactacatatttattttcctttg 9713833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 132
Target Start/End: Complemental strand, 16952611 - 16952563
Alignment:
85 tggtgactt-atagatatcggttcaatacgaactacatatttattttcc 132  Q
    ||||||||| || ||||||||||||||| || |||||||||||||||||    
16952611 tggtgacttgattgatatcggttcaataggagctacatatttattttcc 16952563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2040 times since January 2019
Visitors: 3811