View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_20 (Length: 379)
Name: NF0610_low_20
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0610_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 39 - 364
Target Start/End: Complemental strand, 36887277 - 36886952
Alignment:
| Q |
39 |
agactctaagatcataatgatattgataattgttatccgtgttctatgtcaaaatgcagaaacattcaagggttagacctcactgggagtctatgcaggc |
138 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36887277 |
agaccctaagatcagaatgatattgataattggtatccgtgttctatgtcaaaatgcagaaacattcaagggttagacctcactgggagtctatgcaggc |
36887178 |
T |
|
| Q |
139 |
tttataatctccgaaatttgaaacagctgtgagtgtttttgaatttgcaaggcattagtattagattcttatattaggatatgtgaatttcaagttatgc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36887177 |
tttataatctccgaaatttgaaacagctgtgagtgtttttgattttgcaaggcattagtattagattcttatatcaggatatgtgaatttcaagttatgc |
36887078 |
T |
|
| Q |
239 |
tattaattgacctgtttccatgtttttggtttttgtaggtatgtcagttctaataacatagtgggcgaaataccgtttggtttaccccccaatgtcacac |
338 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36887077 |
tattaattaacttgtttccatatttttggtttttgtagggatgtcagttctaataacatagtgggcgaaatgccgtttggtttaccccccaatgtcacac |
36886978 |
T |
|
| Q |
339 |
atatgtaaggcaactgttcttctcat |
364 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36886977 |
atatgtaaggcaactgttcttctcat |
36886952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 279 - 357
Target Start/End: Complemental strand, 22557218 - 22557140
Alignment:
| Q |
279 |
atgtcagttctaataacatagtgggcgaaataccgtttggtttaccccccaatgtcacacatatgtaaggcaactgttc |
357 |
Q |
| |
|
|||||||||| || | |||| |||| ||||| || | ||| ||||||||||||| |||||||||||||| | ||||||| |
|
|
| T |
22557218 |
atgtcagttccaacagcataatgggtgaaattccatatggattaccccccaatgccacacatatgtaagcctactgttc |
22557140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2619 times since January 2019
Visitors: 3822