View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_26 (Length: 306)
Name: NF0610_low_26
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0610_low_26 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 30 - 306
Target Start/End: Original strand, 26374313 - 26374589
Alignment:
| Q |
30 |
gaagcttcggagaaaggtgaagcatttccaaggcctgtagtctaagctccacagggtaatcagcaacacacccgattctcggaccagctccagttgacca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26374313 |
gaagcttcggagaaaggtgaagcatttccaaggcctgtagtctaagctccacagggtaatcagcaacacacccgattctcggaccagctccagttgacca |
26374412 |
T |
|
| Q |
130 |
tttacgcgaaagtctatgtcccaattggtaggactttgaacccttcttggaattgattctttgcaatatagaagtcttgggcacctcggtcgttcttgga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26374413 |
tttacgcgaaagtctatgtcccaattggtaggactttgaacccttcttggaattgattctttgcaatatagaagtcttgggcacctcggtcgttcttgga |
26374512 |
T |
|
| Q |
230 |
ctctgaagaccacctgatagagtccttttataactactaacctccaaactgagttgaggagcgtctttcttgtctac |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26374513 |
ctctgaagaccacctgatagagtccttttataactactaacctccaaactgagttgaggagcgtctttcttgtctac |
26374589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1934 times since January 2019
Visitors: 3810