View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_27 (Length: 299)
Name: NF0610_low_27
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0610_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 28342896 - 28342606
Alignment:
| Q |
1 |
caaatagtagctgtagaatttgatagtttttggaatgattgggatccaagttctgatcatgttggaatcaatgttaattcgattcaatcggttcaaaatg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28342896 |
caaatagtagctgttgaatttgatagttataggaatgattgggatccaaattctgatcatgttggaatcaatgttaattcgattcaatcggttcaaaatg |
28342797 |
T |
|
| Q |
101 |
tttcttggaagagtagcataaaaaccggtgccgttgcgaatgcttggatatcatataactcaactacaaaaaacctttctgtttttcttacgtatgttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28342796 |
tttcttggaagagtagcataaaaaccggtgcggttgcgaatgcttggatatcatataactcaactacaaaaaacctttctgtttttcttacttatgttaa |
28342697 |
T |
|
| Q |
201 |
taatccaacttttcatgaaaactctactctttcatataatattgatttgagtgaagttttgccagaatatgttaggattggtttctctgct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28342696 |
taatccaacttttcatgaaaactctactctttcatataatattgatttgagtgaagttttgccagaatatgttaggattggtttttctgct |
28342606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2382 times since January 2019
Visitors: 3818