View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_3 (Length: 651)
Name: NF0610_low_3
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0610_low_3 |
 |  |
|
| [»] scaffold0182 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 4e-92; HSPs: 16)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 4e-92
Query Start/End: Original strand, 233 - 471
Target Start/End: Complemental strand, 30056066 - 30055817
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaagaga |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30056066 |
cttagggagagcctgccgtccatttgggttccacaatgctcgagggattagtctctttagttgcgtgcgggggatattcgattgacacccaaaaaagaga |
30055967 |
T |
 |
| Q |
333 |
ttctcgttaacaacaaaattttatctataacaatatataaagcgaatgcgtgattttttgagttgaatttttcattatagttatattcgtgaaca----- |
427 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
30055966 |
tactcgttaacaacaaaattttatctataacaatatataaagcgaatgcatgattttttgagttgaatttttcattataattatactcgtgaacaaattt |
30055867 |
T |
 |
| Q |
428 |
------aagaatgatatattagttggtaaaagattctctgaaaaaacatc |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055866 |
gtttgtaagaatgatatattagttggtaaaagattctctgaaaaaacatc |
30055817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 496 - 639
Target Start/End: Complemental strand, 30055542 - 30055402
Alignment:
| Q |
496 |
aaaaaacatacatggtgtcaatttcgaccaaaaaacaagaaaggaaacacatattcatcctgttgttccggtcttagaaccggtttaagtgcagagaaac |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055542 |
aaaaaacatacatggtgtcaatttcgaccaaaaaacaagaaaggaaacacatatacatcctgttgttccggtcttagaaccggtttaagtgcagagaaac |
30055443 |
T |
 |
| Q |
596 |
cggattattattagttccaagaacagtgaccttatcattcattc |
639 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055442 |
cggatt---attagttccaagaacagtgaccttatcattcattc |
30055402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 233 - 328
Target Start/End: Complemental strand, 4125089 - 4124994
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| ||||| |||||| |
|
|
| T |
4125089 |
cttagggagagcctgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgatttacaccaaaaaaa |
4124994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 57 - 140
Target Start/End: Complemental strand, 39566948 - 39566866
Alignment:
| Q |
57 |
tgtcattttacaagtatacttctttctttcctctcaatttctattcactttcacttcaaccaaacaacccacaaaatcatatca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
39566948 |
tgtcattttacaagtatacttctttctttcctctcactttctattcactttcacttcaaccaaacaa-ccgcaaaatcatatca |
39566866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 2744009 - 2744084
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
2744009 |
cttagggagagcatgtcgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
2744084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 7839318 - 7839243
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
7839318 |
cttagggagagcatgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
7839243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 233 - 306
Target Start/End: Complemental strand, 12958150 - 12958077
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggagga |
306 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
12958150 |
cttagggagagcctgtcgcccatttgggtcccacaatgctcgagggattagtctccgcagtagcgcgcggagga |
12958077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 233 - 303
Target Start/End: Original strand, 30936080 - 30936150
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcgga |
303 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
30936080 |
cttagggagagcctgccgcccatttgggtccgacaatgttcgagggattagtctccgcagttgcgcgcgga |
30936150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 233 - 328
Target Start/End: Complemental strand, 13468810 - 13468715
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||| ||||| |||||| ||||||| ||||||||||||| || ||||||||||||||||||||| ||||||||| || || |||||||||||| |
|
|
| T |
13468810 |
cttagagagagtctgccgcccatttgagtcccacaatgctcgaaggattagtctccgcagttgcgcacggaggatacccggtttacacccaaaaaa |
13468715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 236 - 304
Target Start/End: Complemental strand, 19715788 - 19715719
Alignment:
| Q |
236 |
agggagagcctgccgtccatttgggtcccacaatgcttga-gggattagtctccgcagttgcgtgcggag |
304 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
19715788 |
agggagagcttgccgcccatttgggtcccacaatgctcgaggggattagtctccgcagttgcgcgcggag |
19715719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 233 - 287
Target Start/End: Original strand, 15683005 - 15683059
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctc |
287 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
15683005 |
cttagggagagcctgccgcccatttaggtcccacaatgctcgagggattaatctc |
15683059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 260 - 308
Target Start/End: Original strand, 39086855 - 39086903
Alignment:
| Q |
260 |
gtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
39086855 |
gtcccacaatgctcgagggattagtctccgcagttgcacgcggaggata |
39086903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 231 - 327
Target Start/End: Original strand, 8521772 - 8521867
Alignment:
| Q |
231 |
cccttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaa |
327 |
Q |
| |
|
||||| ||||||| ||| | ||||||| ||||||||||||| ||||||||||| ||| |||||||| ||||| |||| ||||| ||||| ||||| |
|
|
| T |
8521772 |
cccttggggagagtctgatgcccatttgagtcccacaatgctcgagggattagtatcc-cagttgcgcgcggaagatacccgatttacaccaaaaaa |
8521867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 252 - 296
Target Start/End: Complemental strand, 36994546 - 36994502
Alignment:
| Q |
252 |
ccatttgggtcccacaatgcttgagggattagtctccgcagttgc |
296 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
36994546 |
ccatttgggtcccacaaggctcgagggattagtctctgcagttgc |
36994502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 233 - 269
Target Start/End: Complemental strand, 8034194 - 8034158
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaat |
269 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
8034194 |
cttagggagagcttgcagtccatttgggtcccacaat |
8034158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 253 - 297
Target Start/End: Original strand, 24988595 - 24988639
Alignment:
| Q |
253 |
catttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
24988595 |
catttgagtcccacaatactcgagggattagtctccgcaattgcg |
24988639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 5e-30; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 29059881 - 29059956
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29059881 |
cttagggagagcctgccgcccatttgggtcccacaatgcttgagggattagtctccgcagttgcgcgcggaggata |
29059956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 31492179 - 31492254
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
31492179 |
cttagggagagcctgccgcccatttaggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
31492254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 62 - 140
Target Start/End: Original strand, 25102276 - 25102354
Alignment:
| Q |
62 |
ttttacaagtatacttctttctttcctctcaatttctattcactttcacttcaaccaaacaacccacaaaatcatatca |
140 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
25102276 |
tttttcaagtatacatctttctttcctctcattttctattcactttcacttcaaccaaacaaaccagaaaatcatatca |
25102354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 233 - 297
Target Start/End: Complemental strand, 19477314 - 19477251
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19477314 |
cttagggagagcttgccggccatttgggtcccacaatgc-tgagggattagtctccgcagttgcg |
19477251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 284
Target Start/End: Original strand, 14545019 - 14545070
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
14545019 |
cttagggagagcctgccgtccatttgggtcccacaatgctcgatggattagt |
14545070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 21747105 - 21747030
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| || ||||||||||||| |||||||| | |||||||||| |
|
|
| T |
21747105 |
cttagggagagcctaccacccatttgggtcccacaatcctcgagggattagtcttcgcagttgtgcgcggaggata |
21747030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 31776494 - 31776569
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||||||| || | |||||||||||||||||| || ||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
31776494 |
cttagggagagccagctgcccatttgggtcccacaatactcgagggattaatcttcgcagttgcgggcggaggata |
31776569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 37339798 - 37339723
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||| ||||| |||||| | |||||||||||| |||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
37339798 |
cttagtgagagtctgccgcctatttgggtcccataatgctcgagggattagtctccgcagttgcgcacggaggata |
37339723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 233 - 296
Target Start/End: Original strand, 28537466 - 28537525
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgc |
296 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28537466 |
cttagggagagcctgccgcccatttgggtcc----atgcttgagggattagtctccgcagttgc |
28537525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 220 - 297
Target Start/End: Complemental strand, 29428870 - 29428793
Alignment:
| Q |
220 |
atccaaacagacccttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
||||||||| | |||||||||||| ||||| |||||||| |||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
29428870 |
atccaaacaaagccttagggagagtttgccgaccatttggatcccacaatgttcgagggattagtctctgcagttgcg |
29428793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 57 - 124
Target Start/End: Original strand, 36030932 - 36031000
Alignment:
| Q |
57 |
tgtcattttacaagtatacttctttctttcctctcaatttctattcactttcactt-caaccaaacaac |
124 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
36030932 |
tgtcattttataaatatacttctttctttcttctcactttctattcactttcacttaaaaccaaacaac |
36031000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 254 - 308
Target Start/End: Original strand, 28665187 - 28665241
Alignment:
| Q |
254 |
atttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
28665187 |
attttggtcccacaatgctcgagggattagtctccgcagttgcacgcggaggata |
28665241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 233 - 282
Target Start/End: Complemental strand, 13254166 - 13254117
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggatta |
282 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
13254166 |
cttagggagagcctgccgcccatttaggtcccacaatgctcgagggatta |
13254117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 233 - 297
Target Start/End: Original strand, 20207573 - 20207637
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||| ||||||| ||||| ||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20207573 |
cttaaggagagcttgccgcgcatttggatcctacaatgctcgagggattagtctccgcagttgcg |
20207637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 253 - 297
Target Start/End: Original strand, 1424669 - 1424713
Alignment:
| Q |
253 |
catttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
1424669 |
catttgggtcccacaagacttgagagattagtctccgcagttgcg |
1424713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 304
Target Start/End: Original strand, 24172285 - 24172356
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggag |
304 |
Q |
| |
|
||||| |||||| ||||| ||| |||| |||||||||||| || |||||||||| ||||||||| |||||| |
|
|
| T |
24172285 |
cttagtgagagcttgccgcccacttggatcccacaatgctcgaaggattagtctatgcagttgcgcgcggag |
24172356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 35707922 - 35707997
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||| | |||| |||||| | ||| |||||||| |||||||||||||| ||||||||| | |||||||| |
|
|
| T |
35707922 |
cttagggagaacttgcctcccatttagatcctacaatgctcgagggattagtctctgcagttgcgcgtggaggata |
35707997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 234 - 309
Target Start/End: Original strand, 32469993 - 32470070
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccaca--atgcttgagggattagtctccgcagttgcgtgcggaggatat |
309 |
Q |
| |
|
||||||||| | ||||||||||||||||| |||| ||||| ||| ||||||| | ||||||||| ||||||||||| |
|
|
| T |
32469993 |
ttagggagaacttgccgtccatttgggtctcacaatatgctcgagagattagtgttcgcagttgcacgcggaggatat |
32470070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 234 - 308
Target Start/End: Complemental strand, 42741872 - 42741799
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||| |||||| |||||||||| ||| ||| || ||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
42741872 |
ttagggagaacctgccacccatttgggt-ccataatactcgagggattaatctctgcagttgcgcgcggaggata |
42741799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 233 - 297
Target Start/End: Complemental strand, 8839346 - 8839282
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||||||||| |||||| | |||| | ||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
8839346 |
cttagggagaatctgccgcctatttagatcccacaatactcgagggattagtctccgcaattgcg |
8839282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 246 - 294
Target Start/End: Original strand, 33299168 - 33299216
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctccgcagtt |
294 |
Q |
| |
|
|||| ||||||||| | ||||||||||| | |||||||||||||||||| |
|
|
| T |
33299168 |
tgccatccatttggattccacaatgcttaatggattagtctccgcagtt |
33299216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 249 - 297
Target Start/End: Original strand, 45778956 - 45779004
Alignment:
| Q |
249 |
cgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
||||| |||| ||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
45778956 |
cgtccgtttgagtctcacaatactcgagggattagtctccgcagttgcg |
45779004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 5e-30; HSPs: 19)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 5394472 - 5394567
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
5394472 |
cttagggagagcctgccgcccatttgggtcccacaatgctcgtgggattagtctccgcagttgcacgcggaggatactcgatttacacccaaaaaa |
5394567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 234 - 308
Target Start/End: Original strand, 25423821 - 25423895
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| |||||||||||||| ||||||||| | |||||||| |
|
|
| T |
25423821 |
ttagggagaacctgccgcccatttgggtcccacaatgctcgagggattagtctcagcagttgcgcgtggaggata |
25423895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 233 - 309
Target Start/End: Complemental strand, 9438201 - 9438125
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatat |
309 |
Q |
| |
|
|||||| ||| ||||||| ||||||| ||||||||||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
9438201 |
cttaggaagaacctgccgcccatttgtgtcccacaatgcttgagggattagtttccacagttgcgcgcggaggatat |
9438125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 17981574 - 17981648
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
17981574 |
cttagggagagcttgccg-caatttgggtcccacaatgctcgagagattagtctccgcagttgcgcgcggaggata |
17981648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 328
Target Start/End: Complemental strand, 37180066 - 37179971
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||| || ||||||||||||| |||| ||||| |||||||||| ||||| ||||| |||||| |
|
|
| T |
37180066 |
cttagggagagtgtgccgcccatttgagtcccacaatactcgagggattagtctacgcacttgcgcgcggaggatacccgatttacaccaaaaaaa |
37179971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 234 - 308
Target Start/End: Complemental strand, 13835521 - 13835447
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||||| |||||| |||||| ||||||||||| ||||||||||||| || ||||||| ||| |||||||| |
|
|
| T |
13835521 |
ttagggagagcttgccgttcatttgagtcccacaatgtttgagggattagtttctgcagttgtgtgtggaggata |
13835447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 234 - 308
Target Start/End: Complemental strand, 31579293 - 31579219
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||| |||||| |||||| ||||||||||||| |||| |||||| |||||||||||| |||||||||| |
|
|
| T |
31579293 |
ttagggagagtctgccgcccatttaagtcccacaatgctcgaggaattagtttccgcagttgcgcgcggaggata |
31579219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 246 - 308
Target Start/End: Complemental strand, 37092247 - 37092185
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
37092247 |
tgccgtccatttgggtcccacagtgctcgagggattagtctccgcagttgtgcacggaggata |
37092185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 233 - 309
Target Start/End: Complemental strand, 18105427 - 18105352
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatat |
309 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||| |||||| || ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
18105427 |
cttatggagagcctgccgcccatttgagtctcacaatactcgagggattagtct-cgcagttgcgcgcggaggatat |
18105352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 240 - 315
Target Start/End: Original strand, 14551557 - 14551632
Alignment:
| Q |
240 |
agagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgatt |
315 |
Q |
| |
|
|||| |||||| | |||||||||| |||||||| ||||||||| |||||||||||||| || ||||||| |||||| |
|
|
| T |
14551557 |
agagtctgccgcctatttgggtcctacaatgctcgagggattaatctccgcagttgcgcgcagaggatactcgatt |
14551632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 42745181 - 42745106
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||||| |||| | | |||||||| |||||||| | |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
42745181 |
cttagggagagtctgctgcctatttgggttccacaatggtcgagggattagtctcagcagttgcgcgcggaggata |
42745106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 233 - 306
Target Start/End: Complemental strand, 7020425 - 7020352
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggagga |
306 |
Q |
| |
|
|||||||||| | ||||| |||||||||||| |||||||| ||| |||||||||| |||||||| |||||||| |
|
|
| T |
7020425 |
cttagggagaacttgccgcccatttgggtcctacaatgctcgagtgattagtctcgacagttgcgcgcggagga |
7020352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 237 - 297
Target Start/End: Original strand, 38743818 - 38743878
Alignment:
| Q |
237 |
gggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||||||| ||||| ||||||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
38743818 |
gggagagcttgccgctcatttggatctcacaatgctttagggattagtctccgcagttgcg |
38743878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 234 - 300
Target Start/End: Complemental strand, 39401133 - 39401067
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgc |
300 |
Q |
| |
|
||||||||||| | ||||||||| |||||||||||||| | | |||||| |||||||||||||||| |
|
|
| T |
39401133 |
ttagggagagctcgtcgtccatttaggtcccacaatgctcgtgagattagactccgcagttgcgtgc |
39401067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 246 - 307
Target Start/End: Complemental strand, 3562242 - 3562181
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggat |
307 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| | |||||| |||||||||| |||| |||| |
|
|
| T |
3562242 |
tgccgcccatttgggtcccacaaagcttgaggtactagtcttcgcagttgcgcgcggcggat |
3562181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 252 - 301
Target Start/End: Original strand, 17655756 - 17655805
Alignment:
| Q |
252 |
ccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcg |
301 |
Q |
| |
|
|||||||| | |||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
17655756 |
ccatttggattccacaaggctcgagggattagtctccgcagttgcgtgcg |
17655805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 233 - 269
Target Start/End: Complemental strand, 12133295 - 12133259
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12133295 |
cttagggagagcctgccgtccatttgggtcctacaat |
12133259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 233 - 286
Target Start/End: Complemental strand, 14121947 - 14121894
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtct |
286 |
Q |
| |
|
||||| |||| | ||||| ||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
14121947 |
cttagagagaacttgccgcccatttgagtcccacaatgctcgagggattagtct |
14121894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 254 - 294
Target Start/End: Complemental strand, 24412971 - 24412931
Alignment:
| Q |
254 |
atttgggtcccacaatgcttgagggattagtctccgcagtt |
294 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||||| |
|
|
| T |
24412971 |
atttgagtcccacaatacttgaggaattagtctccgcagtt |
24412931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 1e-27; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 5123563 - 5123488
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
5123563 |
cttagggagagcctgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
5123488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 57 - 140
Target Start/End: Original strand, 4922057 - 4922139
Alignment:
| Q |
57 |
tgtcattttacaagtatacttctttctttcctctcaatttctattcactttcacttcaaccaaacaacccacaaaatcatatca |
140 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4922057 |
tgtcattttataagtatacttctttcttttttctcattttctattcactttcacttcaaccaaacaa-ccacaaaatcatatca |
4922139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 10592003 - 10592098
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| ||||| |||||| |
|
|
| T |
10592003 |
cttagggagagtctgccgcccatttgagtcccacaatgctcgagggattagtctctgcagttgcgcgcggaggatacccgatttacaccaaaaaaa |
10592098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 31113410 - 31113485
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||||| || |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
31113410 |
cttagggagagcctaccgcccatttggatcccacaatactcgagggattagtctccgcagttgcgcgcgaaggata |
31113485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 238 - 308
Target Start/End: Complemental strand, 22188058 - 22187988
Alignment:
| Q |
238 |
ggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||| |||||| | |||||||||||||||| || |||||||||||||||||||||||| |||||||||| |
|
|
| T |
22188058 |
ggagagtctgccgcctatttgggtcccacaatactagagggattagtctccgcagttgcgcgcggaggata |
22187988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 30785051 - 30784976
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||| ||||| ||||||| |||| ||||||| | ||||||||||||||||||||||| |||||||||| |
|
|
| T |
30785051 |
cttagggagaatctgccatccatttaggtctcacaatgttcaagggattagtctccgcagttgcgcgcggaggata |
30784976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 234 - 327
Target Start/End: Original strand, 25983742 - 25983835
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaa |
327 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||| |||| | ||| ||||||||||||||||||| ||||||||| || || ||||||||||| |
|
|
| T |
25983742 |
ttagggagagcttgccgcccatttgagtcccataatgttcgagtgattagtctccgcagttgcacacggaggatacccggtttacacccaaaaa |
25983835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 233 - 294
Target Start/End: Original strand, 36212972 - 36213033
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagtt |
294 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
36212972 |
cttagggagagtttgccgcccatttaggtcccacaatgctcgagggattggtctccgcagtt |
36213033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 78 - 123
Target Start/End: Original strand, 8568610 - 8568655
Alignment:
| Q |
78 |
ctttctttcctctcaatttctattcactttcacttcaaccaaacaa |
123 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8568610 |
ctttctttcctttcactttctattcactttcacttctaccaaacaa |
8568655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 252 - 296
Target Start/End: Original strand, 18244679 - 18244723
Alignment:
| Q |
252 |
ccatttgggtcccacaatgcttgagggattagtctccgcagttgc |
296 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
18244679 |
ccatttgggttccacaatacttgagagattagtctccgcagttgc |
18244723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 29553615 - 29553690
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||||| || ||||||||||||||||| |||||| || |||||||||| ||||||| | | |||||||| |
|
|
| T |
29553615 |
cttagggagagtttgtcgtccatttgggtcccagaatgctcaagagattagtctctgcagttgtgcgtggaggata |
29553690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 1e-27; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 31307131 - 31307056
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
31307131 |
cttagggagagcctgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
31307056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 33529333 - 33529428
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| || |||||||||||||||||||||||| ||||||||| | |||| |||||||||||| |
|
|
| T |
33529333 |
cttagggagagcttgccgcccatttgggtcccacaatactggagggattagtctccgcagttgcgcacggaggatacttgatttacacccaaaaaa |
33529428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 233 - 327
Target Start/End: Original strand, 9012346 - 9012440
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaa |
327 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| | ||||||||| |
|
|
| T |
9012346 |
cttagggagagcttgccgcccacttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgatttatacccaaaaa |
9012440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 57 - 140
Target Start/End: Original strand, 14062111 - 14062193
Alignment:
| Q |
57 |
tgtcattttacaagtatacttctttctttcctctcaatttctattcactttcacttcaaccaaacaacccacaaaatcatatca |
140 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| |||||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
14062111 |
tgtcattttataagtatacttctttctgtcctctcattttctattcactttcactacaaacaaacaa-ccacaaaatcatatca |
14062193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 57 - 140
Target Start/End: Complemental strand, 29696761 - 29696679
Alignment:
| Q |
57 |
tgtcattttacaagtatacttctttctttcctctcaatttctattcactttcacttcaaccaaacaacccacaaaatcatatca |
140 |
Q |
| |
|
|||||||||| || ||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
29696761 |
tgtcattttataaatatacttttttctttcctctcactttctattcactttcacttcaaccaaacaa-ccataaaatcatatca |
29696679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 38766165 - 38766240
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||||| |||||| ||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
38766165 |
cttagggagagtctgccgcccatttgggtctcacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
38766240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 234 - 308
Target Start/End: Complemental strand, 51626370 - 51626296
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
51626370 |
ttagggagagtctgccgtccatttgggtcccacagtgctcgagagattagtctccgcagttgcgcgcggaggata |
51626296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 46016225 - 46016320
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| || | ||||||||||| ||||||| | |||||||| ||||| ||||| |||||| |
|
|
| T |
46016225 |
cttagggagagcctgccgcccatttgggtcccacaatgctcgaagaattagtctccgtagttgcgcgtggaggatacccgatttacaccaaaaaaa |
46016320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 234 - 308
Target Start/End: Original strand, 35972420 - 35972494
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35972420 |
ttagggagagtttgccgcccatttgggtcccactatgttcgagggattagtctccgcagttgcgtgcggaggata |
35972494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 14854681 - 14854756
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||| || |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
14854681 |
cttagggagagcttgccgcccatttgggtccaacaattctcgagggattagtctctgcagttgcgcgcggaggata |
14854756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 239 - 308
Target Start/End: Original strand, 15133457 - 15133526
Alignment:
| Q |
239 |
gagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||| || ||||| |||||||||||||||| ||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
15133457 |
gagagcttgtcgtccgtttgggtcccacaatgtttgagagattagtctccgcagttgcgcgcggaggata |
15133526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 296
Target Start/End: Original strand, 45994598 - 45994661
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgc |
296 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
45994598 |
cttagggagagcctgacgcccatttgggtctcacaatgctcgagagattagtctccgcagttgc |
45994661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 233 - 297
Target Start/End: Complemental strand, 35334163 - 35334099
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
||||| ||||| | |||| |||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
35334163 |
cttagagagagtccgccgcccatttgggtcccacaatactcgagggattagtctccgcagttgcg |
35334099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 233 - 303
Target Start/End: Complemental strand, 13948657 - 13948587
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcgga |
303 |
Q |
| |
|
||||||||||| || ||||||||||| || ||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
13948657 |
cttagggagagtctaccgtccatttgaatctcacaatgctcgagggattagtctctgcagttgcgcgcgga |
13948587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 233 - 304
Target Start/End: Original strand, 31308373 - 31308444
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggag |
304 |
Q |
| |
|
|||||| |||| |||||||| |||| |||||||||||| |||||||||||||| | |||||| |||||||| |
|
|
| T |
31308373 |
cttaggaagagtctgccgtctatttaggtcccacaatgtttgagggattagtcctctcagttgtgtgcggag |
31308444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 236 - 296
Target Start/End: Original strand, 13686681 - 13686741
Alignment:
| Q |
236 |
agggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgc |
296 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| ||| ||| ||||||||||| ||||||| |
|
|
| T |
13686681 |
agggagagtttgccgtccatttgggtctcacaaggctcgagagattagtctccacagttgc |
13686741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 246 - 297
Target Start/End: Complemental strand, 25768740 - 25768689
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
||||| |||||||||| ||||||||||||| |||||||||||| || ||||| |
|
|
| T |
25768740 |
tgccgcccatttgggtgccacaatgcttgaaggattagtctccacaattgcg |
25768689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 46250620 - 46250545
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||| ||| ||||||||| ||||||||||||||| ||||| || | |||||||||||| |||| | | |||||||| |
|
|
| T |
46250620 |
cttatggaaagcctgccgcccatttgggtcccacgatgctcgaagaattagtctccgcggttgtgcgtggaggata |
46250545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 1e-27; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 16756158 - 16756253
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
|||||||||||| || ||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||| ||||| |||||| |
|
|
| T |
16756158 |
cttagggagagcatgtcgtgcatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatactcgatttacaccaaaaaaa |
16756253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 42297507 - 42297432
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
42297507 |
cttagggagagtctgccgtccatttgggtctcacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
42297432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 245 - 328
Target Start/End: Original strand, 49071665 - 49071748
Alignment:
| Q |
245 |
ctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||| ||||| ||||| |||||| |
|
|
| T |
49071665 |
ctgccgttcatttgggtcccacaatgctcgagagattagtctccgcagttgcgtgcggaagatatccgatttacaccaaaaaaa |
49071748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 233 - 330
Target Start/End: Original strand, 15642531 - 15642628
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaaga |
330 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||| ||| ||||| |||||||||||||| |||||||||| ||||| ||| |||||||||| |
|
|
| T |
15642531 |
cttagggagagtttgccgcccatttgggtcccacaatgctcgagagattattctccgcagttgcgcgcggaggatacccgatttacatccaaaaaaga |
15642628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 12035626 - 12035721
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| |||||||||||||| ||| |||| | ||| |||| |||||| |||| ||||||| |
|
|
| T |
12035626 |
cttagggagagtctgccgcccatttgggtcccacaatgctcgagggattagtctcagcaattgcacgtggatgatactcgatttacactcaaaaaa |
12035721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 233 - 327
Target Start/End: Original strand, 36806687 - 36806781
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaa |
327 |
Q |
| |
|
||||||||| | |||||| |||||||||| |||||||||| |||||||||||||| |||||||| |||||||||| || || ||||||||||| |
|
|
| T |
36806687 |
cttagggagtgtctgccgcccatttgggttccacaatgctcgagggattagtctctgcagttgcacgcggaggatacccggtttacacccaaaaa |
36806781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 28724748 - 28724823
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||| |||| |||||||||||||| |||| |||||| | |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
28724748 |
cttaggaagagtctgccgtccatttgagtcctacaatgttcgagggattagtctccgcaattgcgcgcggaggata |
28724823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 234 - 308
Target Start/End: Complemental strand, 18428205 - 18428132
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||| |||| |||||||||| ||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
18428205 |
ttagggagagtctgctgtccatttggc-cccacaatgctcgagggattagtctctgcagttgcgcgcggaggata |
18428132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 233 - 304
Target Start/End: Complemental strand, 9781054 - 9780983
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggag |
304 |
Q |
| |
|
||||||||||| | |||| ||||||||||||||||||||| ||||||||||| |||| ||||| | |||||| |
|
|
| T |
9781054 |
cttagggagagtcggccgcccatttgggtcccacaatgctcgagggattagtatccgtagttgggcgcggag |
9780983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 44913185 - 44913260
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||||| ||| |||||||||| |||||| || || ||||||| |
|
|
| T |
44913185 |
cttagggagagcttgccgcccatctgggtcccacaatgctcgagagattagtctctgcagttacgcgcagaggata |
44913260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 233 - 301
Target Start/End: Original strand, 10367580 - 10367648
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcg |
301 |
Q |
| |
|
|||| |||||| || ||| |||||||||||| |||||||| || |||||| |||||||||||||||||| |
|
|
| T |
10367580 |
cttaaggagagtctaccgcccatttgggtccaacaatgctcgaaggattaatctccgcagttgcgtgcg |
10367648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 233 - 297
Target Start/End: Original strand, 46864167 - 46864231
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||||||| | |||||||||||||| ||||||||| |
|
|
| T |
46864167 |
cttagggagaacttgccgtccatttgggtttcacaatgttcgagggattagtctctgcagttgcg |
46864231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 233 - 296
Target Start/End: Original strand, 22022196 - 22022259
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgc |
296 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
22022196 |
cttagggagaacttgccacccatttgggtcccacaatattcgagggattagtctccgcagttgc |
22022259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 233 - 296
Target Start/End: Original strand, 10841093 - 10841157
Alignment:
| Q |
233 |
cttagggagagcctgccgtccattt-gggtcccacaatgcttgagggattagtctccgcagttgc |
296 |
Q |
| |
|
|||||||||| | |||| |||||| ||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
10841093 |
cttagggagaacttgcctcccatttagggtcccacaatgcttgagggattaatttccgcagttgc |
10841157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 328
Target Start/End: Complemental strand, 39547429 - 39547334
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||||| ||| |||||| | |||| |||| ||||||| | || |||||| |||||||||||||| || |||||| | || || |||||||||||| |
|
|
| T |
39547429 |
cttagggggagtctgccgcctatttaggtctcacaatgttcgacggattaatctccgcagttgcgcgcagaggatttccggtttacacccaaaaaa |
39547334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 2e-26; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 234 - 327
Target Start/End: Original strand, 1642683 - 1642776
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaa |
327 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||| ||||| ||||| ||||| |
|
|
| T |
1642683 |
ttagggagagtctaccgtccatttgggtcccacaatacttgagggattagtttccgcagttgcgcgcggaggatatccgatttacaccaaaaaa |
1642776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 230 - 328
Target Start/End: Complemental strand, 48204379 - 48204281
Alignment:
| Q |
230 |
acccttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||| |||||||||| |||||||||||| |||||||||| ||||| |||||||||||| |
|
|
| T |
48204379 |
acccttagggagagcttgtcgtccatttgggttccacaatgctcaagggattagtttccgcagttgcgcgcggaggatacccgatttacacccaaaaaa |
48204281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 233 - 309
Target Start/End: Original strand, 27763797 - 27763873
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatat |
309 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
27763797 |
cttagggagagtctgccgtccatttgagtcccacaatgctcgagggattagtctccgcagttgcgcgcagaggatat |
27763873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 233 - 309
Target Start/End: Complemental strand, 30996030 - 30995954
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatat |
309 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30996030 |
cttagggagagtctgccgcccatctgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatat |
30995954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 38331204 - 38331299
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
||||| |||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||| ||| |||||||| |
|
|
| T |
38331204 |
cttagagagagcttgccgcccatttgggtcccacaatgtttgagggattagtctccgcagttgcacgcggaggatacccgatttacaaccaaaaaa |
38331299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 20861324 - 20861399
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||||| |||||||||||||||||||||| | |||||||||| |
|
|
| T |
20861324 |
cttagggagagcctgccgcccatttgggttccataatgctcgagggattagtctccgcagttgtgcgcggaggata |
20861399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 244 - 308
Target Start/End: Original strand, 8757431 - 8757495
Alignment:
| Q |
244 |
cctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||| | ||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
8757431 |
cctgccgcctatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
8757495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 57 - 140
Target Start/End: Original strand, 50406650 - 50406732
Alignment:
| Q |
57 |
tgtcattttacaagtatacttctttctttcctctcaatttctattcactttcacttcaaccaaacaacccacaaaatcatatca |
140 |
Q |
| |
|
||||||||||||| |||| ||||||||| |||||| ||||||||| ||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
50406650 |
tgtcattttacaaatatatctctttcttttctctcattttctattctctttcacttaaaccaaacaa-ccacaaaatcatatca |
50406732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 328
Target Start/End: Original strand, 25224775 - 25224870
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaa |
328 |
Q |
| |
|
|||| ||||| | ||||| |||||| |||||||||||||| |||||||||||||||||||||| |||||||||| || || |||||||||||| |
|
|
| T |
25224775 |
cttaaggagaacttgccgcccatttaggtcccacaatgctcaagggattagtctccgcagttgcacgcggaggatacccggtttacacccaaaaaa |
25224870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 55123173 - 55123248
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
55123173 |
cttagggagagcttgctacccatttgggtctcacaatgctcgagggattagtcttcgcagttgcgcgcggaggata |
55123248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 234 - 308
Target Start/End: Original strand, 39950289 - 39950363
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||||||| ||| ||| ||||||| ||| |||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
39950289 |
ttagggagaatctgtcgttcatttggatccgacaatgctcgaaggattagtctccgcagttgcatgcggaggata |
39950363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 233 - 330
Target Start/End: Original strand, 46725501 - 46725597
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgattgacacccaaaaaaga |
330 |
Q |
| |
|
|||||||| || ||| |||||| ||||||| ||||||||||||||||||||||| ||||| || |||||||||| | | || |||||||||||||| |
|
|
| T |
46725501 |
cttagggatagtttgctgtccatctgggtcc-acaatgcttgagggattagtctcttcagttacgcgcggaggatacttggtttacacccaaaaaaga |
46725597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 265 - 308
Target Start/End: Complemental strand, 40318482 - 40318439
Alignment:
| Q |
265 |
acaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
40318482 |
acaatgttcgagggattagtctccgcagttgcgcgcggaggata |
40318439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 246 - 309
Target Start/End: Complemental strand, 44941316 - 44941254
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatat |
309 |
Q |
| |
|
||||| |||||||| ||||| ||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
44941316 |
tgccgcccatttggatcccattatgctcgagg-attagtctccgcagttgcgcgcggaggatat |
44941254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 246 - 288
Target Start/End: Original strand, 15446085 - 15446127
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctcc |
288 |
Q |
| |
|
||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
15446085 |
tgccgtccatttgggtctcacaatgctcgacggattagtctcc |
15446127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 246 - 286
Target Start/End: Original strand, 15283160 - 15283200
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtct |
286 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
15283160 |
tgccgcccatttgggtcccacaatgctcgagagattagtct |
15283200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 233 - 297
Target Start/End: Original strand, 40294688 - 40294752
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcg |
297 |
Q |
| |
|
|||||||| ||| ||||| |||||| ||||||||| || || ||||||||||||||||||||| |
|
|
| T |
40294688 |
cttagggaaagcttgccgctcatttgaatcccacaatactcgaaggattagtctccgcagttgcg |
40294752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 56; Significance: 7e-23; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 26407 - 26482
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
26407 |
cttagggagagcctgccgcccatttgggtcccacaatgttcgagagattagtctccgcagttgcgcgcggaggata |
26482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 7e-23; HSPs: 11)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 12836962 - 12836887
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
12836962 |
cttagggagagctcgccgcccatttgggtcccacaatgcttgagggattagtctccccagttgcgcgcggaggata |
12836887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 234 - 309
Target Start/End: Original strand, 9536844 - 9536919
Alignment:
| Q |
234 |
ttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatat |
309 |
Q |
| |
|
||||||||||||| |||||||||| | | |||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
9536844 |
ttagggagagcctaccgtccatttagattccacaatgctcgagggattagtctccgcagttgcgctcggaggatat |
9536919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 12411224 - 12411299
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||| |||| |||||| |||||| ||||||||||||||||||||||||||||| |||||||| |||| ||||| |
|
|
| T |
12411224 |
cttaggaagagtctgccgcccatttaagtcccacaatgcttgagggattagtctccacagttgcgcgcgggggata |
12411299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 233 - 315
Target Start/End: Original strand, 31412198 - 31412280
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgatt |
315 |
Q |
| |
|
||||||||||| |||||| |||||||||| |||||||||| ||| |||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
31412198 |
cttagggagagtctgccgcccatttgggttccacaatgctcgagaaattagtctccacagttgcgcacggaggatatccgatt |
31412280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 249 - 308
Target Start/End: Original strand, 28099335 - 28099394
Alignment:
| Q |
249 |
cgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||| || ||| |||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
28099335 |
cgtccatttgagttccataatgctcgagggattagtctccgcagttgcgagcggaggata |
28099394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 233 - 301
Target Start/End: Original strand, 6062118 - 6062186
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcg |
301 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||| |||| | | || |||||||||| |||||||||||||| |
|
|
| T |
6062118 |
cttaggaagagcttgccgttcatttgggtcctacaacgttcgatggattagtcttcgcagttgcgtgcg |
6062186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 245 - 284
Target Start/End: Original strand, 423743 - 423782
Alignment:
| Q |
245 |
ctgccgtccatttgggtcccacaatgcttgagggattagt |
284 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
423743 |
ctgccgtccatttgagtcccacaatgctcgagggattagt |
423782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 315
Target Start/End: Original strand, 1534328 - 1534408
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggatattcgatt |
315 |
Q |
| |
|
|||||||||||| || || ||||||| ||| ||||||||| |||| ||| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
1534328 |
cttagggagagcttgtcgcccatttgagtcgcacaatgctcgaggaattgatctccgcagttgc--gcggaggatatccgatt |
1534408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 246 - 301
Target Start/End: Complemental strand, 21028894 - 21028839
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcg |
301 |
Q |
| |
|
||||| |||||||||| |||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
21028894 |
tgccgcccatttgggtgccacaaggctcaagggattagtctccgcagttgtgtgcg |
21028839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 246 - 301
Target Start/End: Complemental strand, 21029031 - 21028976
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcg |
301 |
Q |
| |
|
||||| |||||||||| |||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
21029031 |
tgccgcccatttgggtgccacaaggctcaagggattagtctccgcagttgtgtgcg |
21028976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 21910281 - 21910355
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
||||| ||||| |||||| ||||| ||||||||||| || |||||||||||||||||||||| |||||||||| |
|
|
| T |
21910281 |
cttagagagagtctgccgctcatttaggtcccacaatactc-agggattagtctccgcagttgcacgcggaggata |
21910355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 233 - 308
Target Start/End: Complemental strand, 27290 - 27215
Alignment:
| Q |
233 |
cttagggagagcctgccgtccatttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||| ||||| |||||||| || ||| ||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
27290 |
cttagggagagcttgccgcccatttggatctcacgatgctcgagggattagtcttcgcagttgcgcgcggaggata |
27215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 253 - 308
Target Start/End: Complemental strand, 29197 - 29142
Alignment:
| Q |
253 |
catttgggtcccacaatgcttgagggattagtctccgcagttgcgtgcggaggata |
308 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||| |||||||||| |
|
|
| T |
29197 |
catttgggtcccacaatgctcgtgggattagtctccacagttgcgcgcggaggata |
29142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 16107 - 16065
Alignment:
| Q |
246 |
tgccgtccatttgggtcccacaatgcttgagggattagtctcc |
288 |
Q |
| |
|
||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
16107 |
tgccgtccatttgggtctcacaatgctcgacggattagtctcc |
16065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University