View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0610_low_31 (Length: 277)

Name: NF0610_low_31
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0610_low_31
NF0610_low_31
[»] chr4 (1 HSPs)
chr4 (29-241)||(39775616-39775828)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 241
Target Start/End: Complemental strand, 39775828 - 39775616
Alignment:
29 acaaacatcccttgtctggttacgttgttttatacgatagctttgaattggtaagtggaaaaaatcttcgtcattgtcaacaattggtaagatgcagact 128  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||    
39775828 acaaaaatcccttgtctggttacgttgttttatacgatagctttgaattggtaagtggaaaatatcttcgtcattgtcgacaattggtaagatgcagact 39775729  T
129 aatcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgc 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39775728 aatcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgc 39775629  T
229 acaaacatttcat 241  Q
    |||||||||||||    
39775628 acaaacatttcat 39775616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University