View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_31 (Length: 277)
Name: NF0610_low_31
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0610_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 241
Target Start/End: Complemental strand, 39775828 - 39775616
Alignment:
Q |
29 |
acaaacatcccttgtctggttacgttgttttatacgatagctttgaattggtaagtggaaaaaatcttcgtcattgtcaacaattggtaagatgcagact |
128 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
39775828 |
acaaaaatcccttgtctggttacgttgttttatacgatagctttgaattggtaagtggaaaatatcttcgtcattgtcgacaattggtaagatgcagact |
39775729 |
T |
 |
Q |
129 |
aatcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgc |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39775728 |
aatcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgc |
39775629 |
T |
 |
Q |
229 |
acaaacatttcat |
241 |
Q |
|
|
||||||||||||| |
|
|
T |
39775628 |
acaaacatttcat |
39775616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2216 times since January 2019
Visitors: 3815