View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_32 (Length: 270)
Name: NF0610_low_32
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0610_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 96 - 161
Target Start/End: Complemental strand, 47999805 - 47999741
Alignment:
Q |
96 |
tttgagccttaagttaattgatggatttccgtcactttgttgtttcattgccataggtttttgttc |
161 |
Q |
|
|
||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
T |
47999805 |
tttgacccttaagttaattgatggatttc-gtcactttgttgtttcattaccataggttttcgttc |
47999741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 49 - 90
Target Start/End: Complemental strand, 47999885 - 47999844
Alignment:
Q |
49 |
atgaggtcattcaaatagtcgctagcgacaacaaagtggact |
90 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47999885 |
atgaggtcattcaaatagtcgctagcgacaacaaagtggact |
47999844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 211 - 243
Target Start/End: Complemental strand, 47999742 - 47999710
Alignment:
Q |
211 |
tctggtttgatgttttgggttggctttcatctc |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
47999742 |
tctggtttgatgttttgggttggctttcatctc |
47999710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1903 times since January 2019
Visitors: 3810