View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0610_low_36 (Length: 254)

Name: NF0610_low_36
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0610_low_36
NF0610_low_36
[»] chr2 (1 HSPs)
chr2 (107-193)||(1612714-1612801)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 107 - 193
Target Start/End: Original strand, 1612714 - 1612801
Alignment:
107 gaatttatgttgcttgatactaacttaccgacctccaaa-tattttttaggatttgtttattaaaatatttctttttataatatctat 193  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
1612714 gaatttatgttgcttgatactaacttaccgacctccaaaatattttttaggatttgtttattaaaatatttctttttataatatctat 1612801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University