View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_36 (Length: 254)
Name: NF0610_low_36
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0610_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 107 - 193
Target Start/End: Original strand, 1612714 - 1612801
Alignment:
Q |
107 |
gaatttatgttgcttgatactaacttaccgacctccaaa-tattttttaggatttgtttattaaaatatttctttttataatatctat |
193 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1612714 |
gaatttatgttgcttgatactaacttaccgacctccaaaatattttttaggatttgtttattaaaatatttctttttataatatctat |
1612801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University