View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_38 (Length: 250)
Name: NF0610_low_38
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0610_low_38 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 56 - 250
Target Start/End: Complemental strand, 5488658 - 5488458
Alignment:
| Q |
56 |
tttgtatgtattaaaaaagctttggagaatgttgattatgcttttcttgtgaatttggaataacactaactttaacatgaaattaatcaaattctcttcc |
155 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5488658 |
tttgtaagtattaaaaaagctttggagaatgttgattatgcttttcttgtgaatttggaa---cactaactttaacatgaaattaatcaaattctcttcc |
5488562 |
T |
|
| Q |
156 |
aacatgagctcctttggtatcaaaaat-aag--------ggaacattgttggttataatgggtggcatcttcttcaaattgcttttacctcccaagctca |
246 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5488561 |
aacatgagctcctttggtattaaaaatcaagggaaaattggaacattgttggttataatgggtggcatcttcttcaaattgcttttacctcccaagctca |
5488462 |
T |
|
| Q |
247 |
tatt |
250 |
Q |
| |
|
|||| |
|
|
| T |
5488461 |
tatt |
5488458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3099 times since January 2019
Visitors: 3831