View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_40 (Length: 236)
Name: NF0610_low_40
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0610_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 6803975 - 6804110
Alignment:
| Q |
1 |
ccgctttgctcaatatagatacagacactaaattataattcatatcaggaacatggagaacattacttaatgagaggatttttcctaaagtgagtttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6803975 |
ccgctttgctcaatatagatacagacactaaattataattcatatcaggaacatggagaacattacttaatgagaggatttttcctgaagtgagtttcaa |
6804074 |
T |
 |
| Q |
101 |
gttcacctttcctttaccaagaacagtggctgttct |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6804075 |
gttcacctttcctttaccaagaacagtggctgttct |
6804110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 14059964 - 14059899
Alignment:
| Q |
1 |
ccgctttgctcaatatagatacagacactaaattataattcatatcaggaacatggagaacattac |
66 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |||||| ||| ||||| | |||||||| |
|
|
| T |
14059964 |
ccgctttgctcaatatagacacagacaccaaattataactcatatgaggcacatgtaaaacattac |
14059899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 70
Target Start/End: Original strand, 53730522 - 53730588
Alignment:
| Q |
4 |
ctttgctcaatatagatacagacactaaattataattcatatcaggaacatggagaacattacttaa |
70 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| |||||| ||| |||| | |||||||||||| |
|
|
| T |
53730522 |
ctttgctcaatatagacacagacaccaaattataactcatatgaggcacatataaaacattacttaa |
53730588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 26972660 - 26972729
Alignment:
| Q |
1 |
ccgctttgctcaatatagatacagacactaaattataattcatatcaggaacatggagaacattacttaa |
70 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||||||||| |||||| ||| |||| | |||||||||||| |
|
|
| T |
26972660 |
ccgctttgctcaatatagacacatacaccaaattataactcatatgaggcacatataaaacattacttaa |
26972729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University