View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0610_low_44 (Length: 215)
Name: NF0610_low_44
Description: NF0610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0610_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 9713968 - 9713833
Alignment:
| Q |
1 |
catcgacgatactatattagaaataaatgagctatttacatattagtacggttaatttcacgacccttatatttacagttaatttggtgacttatagata |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9713968 |
catcgacgatactacattagaaataaatgagttatctacatatcagtacggttaattttacgacccttatatttatagttaatttggtgacttatagatg |
9713869 |
T |
|
| Q |
101 |
tcggttcaatacgaactacatatttattttcctttg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9713868 |
tcggttcaatacgaactacatatttattttcctttg |
9713833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 132
Target Start/End: Complemental strand, 16952611 - 16952563
Alignment:
| Q |
85 |
tggtgactt-atagatatcggttcaatacgaactacatatttattttcc |
132 |
Q |
| |
|
||||||||| || ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
16952611 |
tggtgacttgattgatatcggttcaataggagctacatatttattttcc |
16952563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2397 times since January 2019
Visitors: 3818