View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_14 (Length: 498)
Name: NF0611_high_14
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-119; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 126 - 363
Target Start/End: Original strand, 43758210 - 43758447
Alignment:
| Q |
126 |
gaagagcttaattcaactgagaaaatcaaacatgggagctagtcaatctaccagttgagaagaaagcgataagtgtgaagtggatgtgtaaagtgaagca |
225 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43758210 |
gaagagcttaattcaattgagaaaatcaaacatgggagctagtcaatctaccagttgagaagaaagcgataagtgtgaagtggatgtgtaaagtgaagca |
43758309 |
T |
|
| Q |
226 |
gaattcaagtggaggagtgaccaaatacaaggctagacttaaatctagaggattcttgcagagagcaggaatatattttggtgaagattttgcgcctgtt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43758310 |
gaattcaagtggaggagtgaccaaatacaaggctagacttaaatctagaggattcttgcagagagcagggatatattttggtgaagattttgcgcctgtt |
43758409 |
T |
|
| Q |
326 |
tctagaattgaaactataagaatggcagtaactattac |
363 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
43758410 |
tctagaattaaaactataacaattgcagtaactattac |
43758447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 43 - 117
Target Start/End: Original strand, 43757606 - 43757680
Alignment:
| Q |
43 |
aatatctcctaaattgatccaattgaatgagtgtgagatcaatcgaagcttgcatatgaagatgaagacacaaaa |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43757606 |
aataactcctaaattgatccaattgaatgagtgtgagatcaatcgaagcttgcatatgaagatgaagacacaaaa |
43757680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 29 - 75
Target Start/End: Original strand, 43757461 - 43757511
Alignment:
| Q |
29 |
ctaagagtttctttaa----tatctcctaaattgatccaattgaatgagtg |
75 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
43757461 |
ctaagagtttctttaagttttatctcctaaattgatccaattgagtgagtg |
43757511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 2e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 210 - 293
Target Start/End: Complemental strand, 32656496 - 32656413
Alignment:
| Q |
210 |
tgtgtaaagtgaagcagaattcaagtggaggagtgaccaaatacaaggctagacttaaatctagaggattcttgcagagagcag |
293 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32656496 |
tgtgtaaagtaaagcagaatccaagtggaggagtgaccaaatacaagactagacttaaatctagaggattcttgcagagagcag |
32656413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 32656555 - 32656506
Alignment:
| Q |
126 |
gaagagcttaattcaactgagaaaatcaaacatgggagctagtcaatcta |
175 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
32656555 |
gaagagcttaattcaattgagaaaatcatacatgggagctagttaatcta |
32656506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 130 times since January 2019
Visitors: 3831