View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_22 (Length: 453)
Name: NF0611_high_22
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 2e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 45 - 287
Target Start/End: Original strand, 34233977 - 34234214
Alignment:
Q |
45 |
gaaatatgaatttagttgatacctaatatctcaagagatggtgagttgttatctgatgccattagagaagatgctgagctannnnnnnnnnnnnnnnnnn |
144 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34233977 |
gaaatatgaatttagttgatacctaatatctcaagagatggtgagttgttatctgatgccattagagaagatgctgagctattcttcttcttct------ |
34234070 |
T |
 |
Q |
145 |
cacgacaaccttcgacttcgattcatacgattactaccatgtttcggnnnnnnn-acggtatgatccgaactactgacatgacccgaaagcccaaatgca |
243 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34234071 |
cacgacaaccttcgacttcgattcattcgattactaccatgtttcggttttttttacggtatgatccgaactactgacatgacccgaaagcccaaatgca |
34234170 |
T |
 |
Q |
244 |
agttctcattgagactcacccaaacaactcaactcaatttacac |
287 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34234171 |
agttctcattgagactcacccaaacaactcaactcaatttacac |
34234214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 375 - 438
Target Start/End: Original strand, 34234315 - 34234378
Alignment:
Q |
375 |
cttcaggtaatttaatggggtctcagaggttcgaaccactgtctctgtataaattatgcaatgt |
438 |
Q |
|
|
|||||||||||||||| ||||||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
T |
34234315 |
cttcaggtaatttaatagggtctcaggggttcgaatcactgtccttgtataaattatgcaatgt |
34234378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 390 - 440
Target Start/End: Original strand, 55383883 - 55383933
Alignment:
Q |
390 |
tggggtctcagaggttcgaaccactgtctctgtataaattatgcaatgttc |
440 |
Q |
|
|
|||||| |||| |||||||||| ||| ||||| |||||||||||||||||| |
|
|
T |
55383883 |
tggggtgtcaggggttcgaacccctgcctctgcataaattatgcaatgttc |
55383933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University