View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_37 (Length: 342)
Name: NF0611_high_37
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_high_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 99 - 320
Target Start/End: Original strand, 1885862 - 1886082
Alignment:
| Q |
99 |
atttctatgtggcaaaatcgcccaatgttggcaacagctagggctttgttaagacataactgttgcgattttgaatccaggtgatatctcctctattatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1885862 |
atttctatgtggcaaaatcgcccaatgttggcagctgctgggtctttgttaagacataactgttgcgattttgaatccaggtgatatctcctctat-att |
1885960 |
T |
|
| Q |
199 |
tttgcaattctgcatcgtttagagccctcacaacagccaatctttagcacgctgatgtggatcatttgaaaaaatagaaataatatggaatgatacctca |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885961 |
tttgcaattctgcatcgtttagagccctcacaacagccaatctttagcacgctgatgtggatcatttgaaaaaatagaaataatatggaatgatacctca |
1886060 |
T |
|
| Q |
299 |
gacaagtgtcaggttatctgtg |
320 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1886061 |
gacaagtgtcaggttatctgtg |
1886082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 232 - 283
Target Start/End: Original strand, 36256769 - 36256820
Alignment:
| Q |
232 |
cagccaatctttagcacgctgatgtggatcatttgaaaaaatagaaataata |
283 |
Q |
| |
|
||||||||||||||||| || |||| || |||||| |||||||||||||||| |
|
|
| T |
36256769 |
cagccaatctttagcacacttatgttgagcatttggaaaaatagaaataata |
36256820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2288 times since January 2019
Visitors: 3818