View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_45 (Length: 268)
Name: NF0611_high_45
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_high_45 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 48 - 268
Target Start/End: Original strand, 32145646 - 32145866
Alignment:
Q |
48 |
gtttgcgcgtgctgccacgtttgactgcatttttcacaatatcaaggattgtggcatgattacaacgtgatgtgaccatgatttaaaacctttctaatgt |
147 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32145646 |
gtttgcgcgtgctgccacgtttgactgcatttgtcacaatatcaaggattgtggcatgattacaacgtgatgtgaccatgatttaaaacctttctaatgt |
32145745 |
T |
 |
Q |
148 |
gattctataaactcagcatggtttgacgatactagcaacttggctttatgcttacacgattctataaactcggcatggtttaaagattacttacaagtag |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
32145746 |
gattctataaactcagcatggtttgacgatactagcaacttggctttatgcttacacgattctataaactcggcatgttttaaagattactagcaagtag |
32145845 |
T |
 |
Q |
248 |
gctttatgctcgaattgctcc |
268 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
32145846 |
gctttatgctcgaattgctcc |
32145866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University