View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_51 (Length: 251)
Name: NF0611_high_51
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 15379831 - 15380074
Alignment:
Q |
1 |
tatgttccaatagcacccttctttttatgatccaagttgcatgacaaaagaccaccagctatgcttccaccagtagtggagcaactgatagctttaaata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15379831 |
tatgttccaatagcacccttctttttatgatccaagttgcatgacaaaagaccaccagctatgcttccaccagtagtggagcaactgatagctttaaata |
15379930 |
T |
 |
Q |
101 |
gagtaagatttctcattgaaaagaagattcagcgatggatggaatcgggatgatccatgggatatgctgaactattgccatttagtttaagtttttgatg |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15379931 |
gagtaagatttctcattgaaaagaagattcagcgatggatggaatcgggatgatccatgtgatatgctgaactattgccatttagtttaagtttttgatg |
15380030 |
T |
 |
Q |
201 |
aatgatcgtaagaataacctaatcttatttcttatcctttgcta |
244 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
15380031 |
aatgatcgtaacaataacctaatcttatttcttatcctttgcta |
15380074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University