View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_52 (Length: 251)
Name: NF0611_high_52
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_high_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 40052722 - 40052928
Alignment:
| Q |
1 |
tgacagaatgtactcaactgcagaataatgagagctgtaatgtatttagtgctggaatatagaagttttttgcagcgaatgcttatgttgcattagcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40052722 |
tgacagaatgtactcaactgcagaataatgagagctgtaatgtatttagtgctggaatatagaagttttttgcagcgaatgtttatgttgcattagcatt |
40052821 |
T |
|
| Q |
101 |
ctgtttgtcatatagaatgcagtttatggttagaatcatgcaaaggaggatatgattggtgcatggtttcatgagttgggcacagctaatattgtagaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40052822 |
ctgtttgtcatatagaatgcagtttatggttagaaccatgcaaaggaggatatgattggtgcatggtttcatgagttgggcacagctaatattgtagaat |
40052921 |
T |
|
| Q |
201 |
agcaaat |
207 |
Q |
| |
|
||||||| |
|
|
| T |
40052922 |
agcaaat |
40052928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 40047734 - 40047910
Alignment:
| Q |
1 |
tgacagaatgtactcaactgcagaataatgagagctgtaatgtatttagtgctggaatataga-agttttttgcagcgaatgcttatgttgcattagcat |
99 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||| |||||||| ||| |||||| |||| || | ||||||||| |||| ||||| | ||||||| | |
|
|
| T |
40047734 |
tgacagaatgtacacaacatcagaataattagaactgtaatgcatt-agtgctttaataaagtcaactttttgcagtaaatgtttatgatccattagctt |
40047832 |
T |
|
| Q |
100 |
tctgtttgtcatatagaatgcagtttatggttagaatcatgcaaaggaggatatgattggtgcatggtttcatgagtt |
177 |
Q |
| |
|
|||| |||||| |||||||||||||||||| ||||||||| | |||||||||||||| | | |||||||||||| |
|
|
| T |
40047833 |
tctgcctgtcatgtagaatgcagtttatggtataaatcatgcactgtaggatatgattggttcgtagtttcatgagtt |
40047910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 316 times since January 2019
Visitors: 3833