View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_57 (Length: 251)
Name: NF0611_high_57
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_high_57 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 95 - 251
Target Start/End: Complemental strand, 51351643 - 51351487
Alignment:
Q |
95 |
ggaaaatgaacgcttttagcttttaacataaaaacattgtcacttcacttcacactcaattatgtttgagtgagtattcgtcaaatataattttgaattg |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
51351643 |
ggaaaatgaacgcttttagcttttaacataaaaacattgtcacttcacttcacactcaattatgtttgagtgattattcgtcaaatataattttgaattg |
51351544 |
T |
 |
Q |
195 |
aatagattttgtaacactgaatttaaagtgaaattatgtatcaactaaacagtgaaa |
251 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51351543 |
aatagattttgtaaccctgaatttaaagtgaaattatgtatcaactaaacagtgaaa |
51351487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 9 - 80
Target Start/End: Complemental strand, 51351971 - 51351901
Alignment:
Q |
9 |
gagaagaaagcatgagacttgaacaaacactcgaaacatgcacacaaacaagtaacaaacattttttcccaa |
80 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
51351971 |
gagaagaaagcatgagacttgaacaaacactcgaaacatgcacacaaacaagtaac-aacattttttcccaa |
51351901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University