View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_high_58 (Length: 250)
Name: NF0611_high_58
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_high_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 20484622 - 20484863
Alignment:
| Q |
1 |
cctacattataa-gggttacaacactattaaccctagaaaaaattgtcaccactttgttcttgttggagtggtacctcatttttaattagactatggaag |
99 |
Q |
| |
|
|||||||||||| ||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20484622 |
cctacattataaaggggtaaagcactattaaccctagaaaaaattgtcaccactttgttcttgttggagtggtacctcatttttaattagactgtggaag |
20484721 |
T |
|
| Q |
100 |
agaccccccttaattccgctaaggtggtgcagccgatagtgctgttgtacaagaaagggcggtctattactaggaattgcaatttga-catttcctggcc |
198 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| || |
|
|
| T |
20484722 |
agaccccccttaatttcgctaaggtggtgcagccgatagtgctgttgtacaagaaagggcggtctattactaggaattgcaatttgaccgtttcctgacc |
20484821 |
T |
|
| Q |
199 |
tcttttttccgaacttcactttctagttcatgaatccctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20484822 |
tcttttttccgaacttcactttctagttcatgaatccctatg |
20484863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 111 times since January 2019
Visitors: 3831