View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0611_low_27 (Length: 454)

Name: NF0611_low_27
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0611_low_27
NF0611_low_27
[»] chr4 (2 HSPs)
chr4 (45-288)||(34233977-34234214)
chr4 (376-439)||(34234315-34234378)
[»] chr3 (1 HSPs)
chr3 (391-441)||(55383883-55383933)


Alignment Details
Target: chr4 (Bit Score: 154; Significance: 2e-81; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 45 - 288
Target Start/End: Original strand, 34233977 - 34234214
Alignment:
45 gaaatatgaatttagttgatacctaatatctcaagagatggtgagttgttatctgatgccattagagaagatgctgagctannnnnnnnnnnnnnnnnnn 144  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                       
34233977 gaaatatgaatttagttgatacctaatatctcaagagatggtgagttgttatctgatgccattagagaagatgctgagctattcttcttcttct------ 34234070  T
145 cacgacaaccttcgacttcgattcatacgattactaccatgtttcggnnnnnnnnacggtatgatccgaactactgacatgacccgaaagcccaaatgca 244  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||    
34234071 cacgacaaccttcgacttcgattcattcgattactaccatgtttcggttttttttacggtatgatccgaactactgacatgacccgaaagcccaaatgca 34234170  T
245 agttctcattgagactcacccaaacaactcaactcaatttacac 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
34234171 agttctcattgagactcacccaaacaactcaactcaatttacac 34234214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 376 - 439
Target Start/End: Original strand, 34234315 - 34234378
Alignment:
376 cttcaggtaatttaatggggtctcagaggttcgaaccactgtctctgtataaattatgcaatgt 439  Q
    |||||||||||||||| ||||||||| |||||||| |||||||  |||||||||||||||||||    
34234315 cttcaggtaatttaatagggtctcaggggttcgaatcactgtccttgtataaattatgcaatgt 34234378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 391 - 441
Target Start/End: Original strand, 55383883 - 55383933
Alignment:
391 tggggtctcagaggttcgaaccactgtctctgtataaattatgcaatgttc 441  Q
    |||||| |||| |||||||||| ||| ||||| ||||||||||||||||||    
55383883 tggggtgtcaggggttcgaacccctgcctctgcataaattatgcaatgttc 55383933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2542 times since January 2019
Visitors: 3822