View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_33 (Length: 431)
Name: NF0611_low_33
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 394
Target Start/End: Complemental strand, 9904169 - 9903778
Alignment:
| Q |
1 |
gaactacctctacttcctatgctaataggctccctgcttaaaccatatctatttactaatttttatacaccaactatacaaattaattacaattttgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9904169 |
gaactacctctacttcctatgctaataggctccctgcttaaaccatatctatttactaatttttatacaccaactatacaaattaattacaattttgaaa |
9904070 |
T |
|
| Q |
101 |
gnnnnnnnnntaatatgaatttcatatgacccaaactcaattgccttatatttcatattgtattttaaagagacctgtattagatgagtgatgatctcaa |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9904069 |
gaaaaaaaa--aatatgaatttcatatgacccaaactcaattgccttatatttcatattgtattttaaagagacctgtattagatgagtgatgatctcaa |
9903972 |
T |
|
| Q |
201 |
caaatgttgatataagtgaagctagttctcatctcacaaaccggttttttgagattgttttaagcaaaaccacaaaatctatgatggtgtcagatcttct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9903971 |
caaatgttgatataagtgaagctagttctcatctcacaaatcggttttttgagattgttttaagcaaaaccacaaaatctatgatggtgtcagatcttct |
9903872 |
T |
|
| Q |
301 |
ttcaaagatttattgaaccacattcaatcagatttctgctattagatcaaccatcgtttatatctacacaccaaacacaatattattggagatg |
394 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9903871 |
tttaaagatttattgaaccacattctatcagatttctgctattagatcaaccatcgtttatatctacacactaaacacaatattattggggatg |
9903778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2129 times since January 2019
Visitors: 3811