View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_37 (Length: 424)
Name: NF0611_low_37
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 14 - 363
Target Start/End: Original strand, 37305250 - 37305609
Alignment:
Q |
14 |
ctgttgccaacaattgtggaatttgagtccacatttgaggtggaagccaccaaatcagtggaaactgataaggaggagggcattttcttgacatgggagg |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
37305250 |
ctgttgccaacaattgtggaatttgagtccacatttgaggtggaagccaccaaatcagtggaaactgataaggaggagggtattttcttgacatgggagg |
37305349 |
T |
 |
Q |
114 |
gc----------gactatttcaaatggaagaaaaccaatacttcaaggtctaaaaggctatgcaaaaccaggacaattcttagctataatgggtctttct |
203 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37305350 |
ggacctttgggtgactatttcaaatggaagaaaaccaatacttcaaggtctaaaaggctatgcaaaaccaggacaattcttagctataatgggtctttct |
37305449 |
T |
 |
Q |
204 |
ggtagtgggaagtcaactcttcttgatgctttagcaaataatgaatggtatctatttaaaatatcttgtttgaccctattactttcatagtttatttaag |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37305450 |
ggtagtgggaagtcaactcttcttgatgctttagcaaataatgaatggtatctatttaaaatatcttgtttgaccctattactttcatagtttatttaag |
37305549 |
T |
 |
Q |
304 |
accctattatgtgatatgtaaatattatcacaagcatttgatgctggctgatgtattcat |
363 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37305550 |
accctattatgtgatatgtaaatattatcacaagcatttgatgctggctgatgtattcat |
37305609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 126 - 239
Target Start/End: Complemental strand, 37348058 - 37347945
Alignment:
Q |
126 |
aatggaagaaaaccaatacttcaaggtctaaaaggctatgcaaaaccaggacaattcttagctataatgggtctttctggtagtgggaagtcaactcttc |
225 |
Q |
|
|
|||| ||| ||| |||| ||||| ||||||| || ||||||||||||| || | || ||||| ||||||| ||||||| |||| || || || |||| |
|
|
T |
37348058 |
aatgaaagcaaatcaattcttcagggtctaactggttatgcaaaaccagctcagcttttggctattatgggtccttctggttgtggaaaatctacacttc |
37347959 |
T |
 |
Q |
226 |
ttgatgctttagca |
239 |
Q |
|
|
|||||||||||||| |
|
|
T |
37347958 |
ttgatgctttagca |
37347945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University