View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_46 (Length: 367)
Name: NF0611_low_46
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 30980543 - 30980190
Alignment:
| Q |
1 |
atatatgaaagtgaagattggataatgaatactaacatatgagccattattggaggaggaaaatgaaagagaacaatcattggcccaaagagagccacgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30980543 |
atatatgaaagtgaagattggataatgaatactaacataggagccattattggaggaggaaaatgaaagagaacaatcattggcccaaagagagccacgg |
30980444 |
T |
 |
| Q |
101 |
ttagaccatgcatccaaaacctcttgatagttcaaattcaaattcaaagcaaaactcttttcatcatccacttcccaaaaaccatcattgtaattttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30980443 |
ttagaccatgcatccaaaacctcttgatagttcaaattcaaattcaaagccaaactcttttcatcatccacttcccaaaaaccatcattgtaattttctc |
30980344 |
T |
 |
| Q |
201 |
tctttattattttcttctcctcatgattgcatttgcttatgttctcatctttcccttcatcaaaggaaaatccttcccattccatgatatcccaatgaag |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30980343 |
tctttattattttcttctcctcataattgcatttgcttatgttctcatctttcccttcatcaaaggaaaatccttcccattccatgatatcccaatgaag |
30980244 |
T |
 |
| Q |
301 |
ctcattactactattacaagtgttttgtggtgatgataccttttcttcttcttc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30980243 |
ctcattactactattacaagtgttttgtggtgatgataccttttcttcttcttc |
30980190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University