View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_49 (Length: 354)
Name: NF0611_low_49
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_49 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 92 - 274
Target Start/End: Complemental strand, 25131720 - 25131536
Alignment:
| Q |
92 |
agtgcccatgctctgcttctgctttctatgttggaagcccagcccaatagccatattctttacttnnnnnnnnnnnga---ggcaaaattgaggcaaatg |
188 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
25131720 |
agtgcccaggctctgcttctgctttcaatgttggaagcccaacccaatagccatattctttacttaaaaaaaaaaaaaccgggcaaaattgaggcaaatg |
25131621 |
T |
 |
| Q |
189 |
ttcaggcgtgtaaaaatgttctatttttcagtcttctccttctctaacttatcgtgactctcccactctcagtgactcaatctctg |
274 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25131620 |
ttcaggcgtgtaaaaatgt-ctatttttcagtcttctccttctctaacttatagtgactctccctctctcagtgactcaatctctg |
25131536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 170 - 273
Target Start/End: Complemental strand, 13570028 - 13569925
Alignment:
| Q |
170 |
ggcaaaattgaggcaaatgttcaggcgtgtaaaaatgttctatttttcagtcttctccttctctaacttatcgtgactctcccactctcagtgactcaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
13570028 |
ggcaaaattgaggcaaatgttcaggcgtgtaaaaatgttctatttttcagtcttctccttctctaacttatcgtgactctccctctcttagtgactcaat |
13569929 |
T |
 |
| Q |
270 |
ctct |
273 |
Q |
| |
|
|||| |
|
|
| T |
13569928 |
ctct |
13569925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 110 - 272
Target Start/End: Complemental strand, 10802516 - 10802349
Alignment:
| Q |
110 |
ctgctttctatgttggaagcccagcccaatagccatattctttacttnnnnnnnnnnnga------ggcaaaattgaggcaaatgttcaggcgtgtaaaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||||||| |
|
|
| T |
10802516 |
ctgctttctatgttggaagcccagcccaatagccatattctttacttaaaaaaaaataaaaaaatgggcaaaattgaggcaaatgttcag-cgtgtaaaa |
10802418 |
T |
 |
| Q |
204 |
atgttctatttttcagtcttctccttctctaacttatcgtgactctcccactctcagtgactcaatctc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
10802417 |
atgttctatttttcagtcttctccttctctaacttatcgtgactctccctctcttagtgactcaatctc |
10802349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 170 - 274
Target Start/End: Original strand, 7731 - 7837
Alignment:
| Q |
170 |
ggcaaaattgaggcaaatgttcaggcgtg--taaaaatgttctatttttcagtcttctccttctctaacttatcgtgactctcccactctcagtgactca |
267 |
Q |
| |
|
|||| |||||||||||||||||||||| | || |||| ||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
7731 |
ggcagaattgaggcaaatgttcaggcgcgcatacaaattttctatttttcggtcttctccttctctaacttaacgtgactctccctctctcagtgactca |
7830 |
T |
 |
| Q |
268 |
atctctg |
274 |
Q |
| |
|
||||||| |
|
|
| T |
7831 |
atctctg |
7837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University