View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_58 (Length: 328)
Name: NF0611_low_58
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 48 - 306
Target Start/End: Complemental strand, 43142544 - 43142286
Alignment:
Q |
48 |
gagagggttgtggtagcactcagccgaatttaacgactgaaaatcaaatataatggaacctgttctaaaccggcccagaccgcttccgaagcataatccg |
147 |
Q |
|
|
|||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| || |
|
|
T |
43142544 |
gagagggttgtggtagcactcaaccgaaattaatgactgaaaatcaaatataatggaaccggttctaaaccggcccaaaccgcttccgaagcataattcg |
43142445 |
T |
 |
Q |
148 |
gtgttttccaaataatggtttggtatatgaaccttaaccaaaaaatattgggttatatggtttggttaaccatgcacagcccattgatgaagacatgtta |
247 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43142444 |
gtgttttccaaataatggtttggtatatgaaccttaaccaaaaaatattgggttatatggtttggttaaccatgcacagcccattgatgaagacatgtta |
43142345 |
T |
 |
Q |
248 |
tcattagtaccattggttttaataggttaaaacatattccggatgaagatatgtgatga |
306 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43142344 |
tcattagtaccattggttttaataggttaaaacatattccggatgaagatatgtgatga |
43142286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University