View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_60 (Length: 324)
Name: NF0611_low_60
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 111 - 245
Target Start/End: Original strand, 11782895 - 11783016
Alignment:
| Q |
111 |
cataatatatcaatatttgtccctttgctgccgttttttaagtttaaaaacaatcacaacgaaacttccaatataaattttaattatttttagttagact |
210 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11782895 |
cataatatattaatatttgtccctttgctgccgttttttaagtttaa-------------gaaacttccaatataaattttaattatttttagttagact |
11782981 |
T |
 |
| Q |
211 |
ttttacacaattcttagatcatattcttggagatg |
245 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||| |
|
|
| T |
11782982 |
ttttacacaattcttagatcatttgcttggggatg |
11783016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 153 - 232
Target Start/End: Original strand, 11777080 - 11777159
Alignment:
| Q |
153 |
tttaaaaacaatcacaacgaaacttccaatataaattttaattatttttagttagactttttacacaattcttagatcat |
232 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11777080 |
tttaaaaacaatcacaacagaatttccaatataaattttaattattcttagttagactttttacacaattcttagatcat |
11777159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University